GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL17077

Query DataSets for GPL17077

Status

Public on Apr 26, 2013

Title

Agilent-039494 SurePrint G3 Human GE v2 8x60K Microarray 039381 (Probe Name version)

Technology type

in situ oligonucleotide

Distribution

commercial

Organism

Homo sapiens

Manufacturer

Agilent Technologies

Manufacture protocol

see manufacturer's web site at http://www.agilent.com/

Description

SurePrint G3 Human GE v2 8x60K Microarray

Design ID: 039494
Design Format: 8 x 60 K
Control Grid: IS-62976-8-V2_60kby8_GX_EQC_201000210
Build Version: hg19:GRCh37:Feb2009

Arrays of this design have barcodes that begin with 16039494 or 2539494.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Probe Names.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

Submission date

Apr 26, 2013

Last update date

Jan 09, 2018

Organization

Agilent Technologies

E-mail(s)

cag_sales-na@agilent.com

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (9521)

More...

GSM1086291, GSM1086292, GSM1094647, GSM1094648, GSM1094649, GSM1094650

Series (574)

More...

GSE44550	THP-1 cells treated with CXCL14
GSE44964	Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment (dataset 2)
GSE44966	Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment

GSE45175	Human lung cancer cell lines DMS-273 (SCLC) and NCI-H1437 (NSCLC): scrambled vs. shRNA clones
GSE46041	Human cellular models for Herpes Simplex Virus, type 1 (HSV-1) using induced pluripotent stem cell derived neuronal lineages
GSE46043	Induced pluripotent stem cell derived neuronal lineages as human cellular models for Herpes Simplex Virus, type 1 (HSV-1) infections
GSE46407	Effect of LOX-PP on the gene expression profile of the A673 cell line (Ewing sarcoma)
GSE47797	Effect of Helicobacter pylori on ATM-dependent DNA damage responses
GSE48559	Identification of MAX signature on MAX deficient SCLC cell lines
GSE48667	Enhancement by Aneustat (OMN54) of docetaxel anticancer activity in a patient-derived prostate cancer tissue xenograft model
GSE48980	Profiling gene expression of ETV2-induced vascular endothelial cells (ETVECs)
GSE49322	ALDH1A3-mediated gene expression in MDA-MB-231 cells and MDA-MB-468 cells
GSE49840	Transcriptomic characterization of the novel avian-origin influenza A (H7N9) virus: specific and intermediate host-response between avian (H5N1 and H7N7) and human (H3N2) viruses.
GSE49892	Global Expression of Molecular Transporters in the Human Vaginal Tract
GSE50061	Gene expression in human breast cancer cell lines regulated by HIC1 gene
GSE50805	The effect of MPO inhibitor on the gene expression profiles in HL-60 cell lines exposed to 1, 2, 4,-benzenetriol
GSE50812	Aiolos promotes anchorage independence by silencing p66Shc transcription in lung carcinoma A549 cells
GSE50888	HMLEN cells with Vector Control vs SNAIL vs SNAIL/FBXO11
GSE50889	Vector Control vs SNAIL vs SNAIL/FBXO11
GSE50943	The effect of inhaled IFNbeta (SNG001) versus placebo on peripheral blood mononuclear cells during an upper respiratory tract infection
GSE52708	The mechanism of elevated S100A6 (Calcyclin) Enhances Tumorigenesis in clear cell renal cell carcinoma
GSE52739	The effect on lincRNA expression by p53 family members.
GSE52810	The effect of miR196a of overall gene expression in oral keratinocytes
GSE52855	Gene expression signatures for ELF4
GSE53063	Identification of TEAD4 target genes in colorectal cancer cells
GSE53189	Analysis of the expression of Ataxin-2-target genes
GSE53317	Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts (Agilent 1-color)
GSE53319	Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts
GSE53613	Gene expression signatures in the skin of focal palmoplantar keratoderma (FPPK) patients
GSE53614	Gene expression signatures of 293T cell lines transfected with mutant TRPV3
GSE53615	Gene expression signatures of HaCaT cell lines transfected with mutant TRPV3
GSE53616	Gene expression signatures in the skin of focal palmoplantar keratoderma (FPPK) patients, and cell lines transfected with mutant TRPV3
GSE54218	Aberrant chromatin acetylation in MLL-AF9 leukemia mediates the response to HDAC inhibition (microarray)
GSE54348	Aberrant chromatin acetylation in MLL-AF9 leukemia mediates the response to HDAC inhibition
GSE54672	Analysis of biological characterization and metastasis-related genes in cell lines derived from the Primary lesion and lymph node metastasis of a squamous cell carcinoma arising in the mandibular gingiva
GSE54758	DNA methylation, H3K27me3, and gene expression statuses of human cancer cell lines and normal cells.
GSE55198	Gene expression analysis of human seminoma samples
GSE55542	Gene expression profiling of HPV-active, HPV-inactive and HPV-negative oropharyngeal squamous cell carcinomas
GSE55543	Gene expression profiling of African American vs European American HPV-negative oropharyngeal squamous cell carcinomas
GSE55544	Gene expression profiling of European American HPV-active, HPV-inactive and HPV-negative oral and oropharyngeal cancers
GSE55545	Gene expression profiling of HPV-inactive and HPV-negative oropharyngeal cancers
GSE55546	Gene expression profiling of HPV-active oropharyngeal cancers and Normal benign uvula, tonsil
GSE55547	Gene expression profiling of HPV-negative oropharyngeal cancers and Normal benign uvula, tonsil
GSE55548	Gene expression profiling of HPV-inactive oropharyngeal cancers and normal benign tissue (uvula, tonsil) from European American patients
GSE55549	Gene expression profiling of HPV-negative oropharyngeal cancers and Normal benign uvula, tonsil from European American patients
GSE55550	Gene expression profiles of oral and oropharyngeal cancers from European American and African American patients
GSE56667	Differential Gene Expression in PARP13 Knockdown
GSE56677	Cytokine stimulation systems approach demonstrates differences in innate and pro-inflammatory host responses between genetically distinct MERS-CoV isolates.
GSE56920	A platform of patient-derived tumor xenografts (EOC-xenografts) to recapitulate the clinicopathology and genetic alterations of ovarian cancer
GSE57006	Ginger compound [6]-shogaol activates Nrf2 in human colon epithelial cells
GSE57122	Oncogenic role of TOX in CTCL
GSE57297	Identification of significant gene regulations for breast cancer from human tissues
GSE57703	SSEA4 is a marker for chemotherapy resistance [mRNA]
GSE57705	SSEA4 is a marker for chemotherapy resistance
GSE58304	Gene expression profiling in MCF-7 cells exposed to blackcurrant extract.
GSE58421	Increased Protein Processing Gene Signature in HDACi-resistant cells predicts response to proteasome inhibitors.
GSE58592	The mRNA expression of FaDu-Ctrl, FaDu-Snail, FaDu-Snail2R cells
GSE58615	DHT-AR, E2-AR and R5020-AR target gene profiles in LNCaP
GSE58741	3-anhydro-6-hydroxy-ophiobolin A inhibits the replication of influenza A virus in vitro and in vivo
GSE58743	Identification of transcripts regulated by CEBPA in K562
GSE59025	The difference of gene expression signatures between CD146+ and CD146- cells in malignant rhabdoid tumor
GSE59136	Identification of KAT6B signature on KAT6B deficient SCLC cell Lines
GSE59308	Differentiation of DLBCL induced by HDAC inhibitors is associated with sensitization to proteasome inhibition
GSE59366	Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma [expression]
GSE59497	Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
GSE59534	High-efficiency cellular reprogramming with microfluidics
GSE59783	Open chromatin mapping identifies transcriptional networks regulating human epididymis epithelial function
GSE60381	Open chromatin mapping identifies transcriptional networks regulating human epididymis epithelial function [Agilent expression]
GSE60427	Toll-like receptor 10 in Helicobacter pylori infection
GSE60564	Notch2 over expression in urinary bladder RT4V6 cell line
GSE60608	Gene expression in human bone marrow Mesenchymal Stem cell line (hMSC-TERTs) during proliferation, quiescence (G0-arrest) and re-activation.
GSE60661	Effect of Helicobacter pylori on ATM-dependent DNA damage responses [cell lines]
GSE60679	A validated gene regulatory network and GWAS identifies early regulators of T-cell associated diseases (Th17 Treg)
GSE60680	A validated gene regulatory network and GWAS identifies early regulators of T-cell associated diseases
GSE60683	LASSIM -a network inference toolbox for genome-wide mechanistic modeling
GSE60765	Identification of genes differentailly expressed in cancer stem-like cells of ovarian serous carcinoma and its clinical significance
GSE61385	Transcript Expression Changes over Time-from-injury in Anterior Cruciate Ligament Tears: Implications for Reconstruction and Repair
GSE61511	Gene expression data of human dermal pilla cells, human induced pluripotent stem cell-derived CD271+CD90+ mesenchymal stem cells before and after the induction toward dermal papilla cells
GSE61843	Inhibition of AK4 expression increases drug sensitivity and elevates mitochondrial ATP synthesis
GSE61957	Tetraspanin CD63 acts as a pro-metastatic factor via β-catenin stabilization
GSE61961	The effect of Tumor Necrosis Factor Receptor 1 (TNFR1) loss on gene expression in beta-catenin-deprive colon cancer cells
GSE62348	Gene expression profile in HCAECs transfected with RNF213 siRNA
GSE62585	Development of NUP98-HOXA9 gene expression signatures
GSE62587	NUP98-HOXA9 role as oncogenic transcription factor
GSE62654	Gene expression of human blood Natural Killer (NK) cells directly after isolation and after manual or automated ex vivo expansion
GSE62775	KAT6B gene deletion as a predictive biomarker to Irinotecan response in small cell lung cancer
GSE62855	Targeting MDM4/MDM2 binding interface for reactivation of p53 in cancer therapy
GSE62871	Right atrial tissue gene expression data from human patients in sinus rhythm (SR) and patients whom post-operative atrial fibrillation (POAF) developed
GSE63043	Anti-cancer effect and gene modulation of ET-743 in human biliary tract carcinoma preclinical models
GSE63197	Human RORγt+ CD34+ cells are lineage-specified progenitors of group 3 RORγt+ innate lymphoid cells
GSE63370	Gene Signature of High White Blood Cell Count in B-precursor Acute Lymphoblastic Leukemia
GSE63520	Increased resistance to proteasome inhibitors in multiple myeloma mediated by cIAP2 overexpression - implications for a combinatorial treatment
GSE63596	The status of lymph node of resectable distant metastaticcolorectal cancer (stage Ⅳ) as a prognostic predictor
GSE63754	Gene expression profile of osteogenically differentiated human adipose-derived stem cells
GSE63870	Identification of markers of early dementia in adults with Down syndrome
GSE63931	Transcription profiling of cutaneous lesions caused by Leishmania braziliensis and normal skin.
GSE64350	GLI1-regulated genes in human mammary epithelial cells and human breast cancer cells
GSE64351	Downstream genes regulated by TSHZ2 in MCF-7 cells
GSE64387	Flavivirus antagonism of type I interferon signaling reveals prolidase as a regulator of IFNAR1 trafficking and expression
GSE64628	siRNA knockdown of GALNT1 in hepatocellular carcinoma HA22T and PLC5 cells
GSE64635	Human CD8 T central memory (Tcm) cells: Control vs. norepinephrine (NE) treated
GSE64999	Gene regulation during differentiation of ovarian cancer stem cells
GSE65003	From the morphologic to the transcriptomic characterization of a compromised 3D in vitro model mimicking atopic dermatitis
GSE65123	Gene expression analysis during acute hepatitis C virus infection associates dendritic cell activation with viral clearance
GSE65233	The effect of THADA knockdown on Huh7 cells
GSE65240	Effects of dexamethasone for primary trabecular meshwork cell gene expression
GSE65274	TSLP-Induced Gene Expression Signature in Primary CRLF2 B-ALL
GSE65397	Effect of fatty acids from CLA-enriched egg yolk on MCF-7 adenocarcinoma cells
GSE65470	Modeling the early phenotype at the neuromuscular junction of spinal muscular atrophy using patient-derived iPSCs
GSE65804	Naïve-like Yellow-Fever specific CD8 T cells and reference CD8 T cell subsets in humans
GSE65875	Effects of polyamidoamine dendrimer on neuronal differentiation from human neural progenitor cells using the neurosphere assay
GSE65880	LASSIM -a network inference toolbox for genome-wide mechanistic modeling [MAF, MYB & GATA3 siRNA]
GSE65931	Study of transcriptional effects of monosodium urate crystal (MSU) on HaCaT keratinocyte cell line.
GSE66244	Identification of expresion patterns after treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE66245	Treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE66403	cGMP inducer effect on cell line Panc-1
GSE66404	The effect of FOXO3 knockdown and PDHA1 knockdown on PDAC cell line Panc-1
GSE66405	mRNA expression profiles in Wilms tumor subtypes
GSE66470	Comparison of gene expression profiles of FCRL5+/CD21-/lo/CD27- and FCRL5-/CD21-/lo/CD27- peripheral B cells from healthy donors
GSE66602	The mRNA expression of FaDu-Ctrl, FaDu-ARID3B cells
GSE66603	let-7 controls cancer stemness through ARID3B
GSE66657	Reproduction of reset cell
GSE67061	Gene expression profiles during human lung tumorigenesis
GSE67193	Transcriptomic signatures of Auger electron radioimmunotherapy using nuclear targeting 111In-trastuzumab for potential combination therapies
GSE67275	lung metastasis 100% vs 0%
GSE67318	Global DNA methylation landscape reveals roles of DNA methylation involved in the regulation of drug metabolizing enzyme [I]
GSE67325	Human ESCs vs Human iPSCs & Human NSCs-ES vs Human NSCs-iPS
GSE67485	Global DNA methylation landscape reveals roles of DNA methylation involved in the regulation of drug metabolizing enzyme
GSE67764	β-arrestin1 is involved in hepatocellular carcinogenesis via an inflammation-mediated Akt signal
GSE67845	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease [Colo205]
GSE67849	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease
GSE68348	Differential gene expression profiling by LSD1 inhibition using novel LSD1 inhibitors (NCD25 and NCD38)
GSE68409	UNCOVERING VULVAR CARCINOMA: AN INTEGRATIVE APPROACH
GSE68633	Gene expression profiling of the human HepaRG hepatocellular carcinoma cell line under WNT3A stimulation.
GSE68906	Identification of time-dependent biomarkers and effects of exposure to volatile organic compounds using high-throughput analysis (expression)
GSE68909	Identification of time-dependent biomarkers and effects of exposure to volatile organic compounds using high-throughput analysis
GSE69024	THP-1 human monocytes Transcriptome following exposure to S-nitrosoglutathione (GSNO)
GSE69328	The effect of STARD3 knockdown on melanoma cell line MeWo
GSE69416	Human ex vivo Lung Perfusion: A Pre-Clinical Model for Lung Disease
GSE69447	Whole-genome microarray analysis of human skin fibroblasts
GSE69551	Transcriptome study of Caco-2 human intestinal cells following exposure to empty or S-nitrosoglutathione-loaded polymeric nanoparticles
GSE69661	The function of ERRalpha in viral infection
GSE69992	Role of MSX1 in Osteogenic Differentiation of Dental Pulp Cells
GSE70146	Difference of gene expression between LPS-stimulated monocytes cultured in the presence NRBCs and those cultured in the absence of NRBCs
GSE70177	Targeting the lineage-specific long non-coding RNA LINC01212 as an effective anti-melanoma therapeutic strategy [2]
GSE70180	Targeting the lineage-specific long non-coding RNA LINC01212 as an effective anti-melanoma therapeutic strategy
GSE70468	Vitamin D receptor expression and associated gene signature in tumor stromal fibroblasts predict clinical outcome in colorectal cancer
GSE70603	Investigation of gene expression responses to acute stress exposure in adults with early childhood adversity experience
GSE70637	Identification of gene expression changes in DLBCL cells by DNMT1 knockdown
GSE70866	BAL cell gene expression is predictive of Mortality in Idiopathic Pulmonary Fibrosis and enriched for Genes of Airway Basal Cells (II)
GSE70867	BAL cell gene expression is predictive of Mortality in Idiopathic Pulmonary Fibrosis and enriched for Genes of Airway Basal Cells
GSE71329	The transcriptional network of wild type ERG and ERG mutant at K362
GSE71342	RNA binding protein TIA1 cytoplasmic expression as an Independent Prognostic Factor in Human Esophageal Squamous Cell Carcinoma (ESCC).
GSE71605	Global changes in gene expression in Caco-2 cell line by treatment with extract from iodine-biofortified carrot and lettuce
GSE72026	Gene expression profiling for intravascular large B-cell lymphoma (IVLBCL)
GSE72028	Gene expression profiling and array CGH analysis for intravascular large B-cell lymphoma (IVLBCL)
GSE72049	Whole genome RNA micro array analysis of Plasmodium berghei sporozoites infected host cells
GSE72100	Increased expression of long non-coding RNAs in T cells from patients with rheumatoid arthritis facilitates the inflammatory responses
GSE72213	Identification of molecular signatures in multiple myeloma
GSE72557	Comparison of gene expression by sheep and human blood stimulated with the TLR4 agonists lipopolysaccharide and monophosphoryl lipid A [human]
GSE72559	Comparison of gene expression by sheep and human blood stimulated with the TLR4 agonists lipopolysaccharide and monophosphoryl lipid A
GSE72946	Cathelicidin insufficiency in patients with fatal leptospirosis
GSE72974	Gene expression analysis reveals the concurrent activation of pro-apoptotic and antioxidant-defensive mechanisms in Flavokawain B and FIH-treated cervical cancer HeLa cells
GSE73078	Next Generation Sequencing Methylation Profiling in Skeletal Muscle from Lean and Obese Subjects [Microarray expression]
GSE73157	Bone marrow micro-environment mediated drug resistance in Acute promyelocytic leukemia
GSE73304	Next Generation Sequencing Methylation Profiling in Skeletal Muscle from Lean and Obese Subjects
GSE73402	Sixty-two lung squamous precancerous and cancer samples obtained from brochoscopy
GSE73486	KG1a cells, irradiated at 8Gy, incubated for 48hr
GSE73680	Gene expression profile of Randall's Plaque tissue
GSE73880	Microarray analysis of Salmonella-infected or uninfected in vitro M cells and Caco-2 cells
GSE73959	CD24 suppresses malignant phenotype by downregulation of SHH transcription through STAT1 inhibition in breast cancer cells [MCF-7]
GSE73960	CD24 suppresses malignant phenotype by downregulation of SHH transcription through STAT1 inhibition in breast cancer cells [HCC1937]
GSE73961	CD24 suppresses malignant phenotype by downregulation of SHH transcription through STAT1 inhibition in breast cancer cells
GSE74068	Genome-wide Expression Profiling in Peripheral Models of XDP
GSE74182	Microarray analysis of regulatory and inflammatory macrophages differentiated with glycolysis inhibitor
GSE74375	Interleukin 2 distinctly activates human basophils in skin disorders
GSE74451	Identification of a novel risk factor for intracranial aneurysms in ADPKD using iPSC models [Agilent]
GSE74453	Identification of a novel risk factor for intracranial aneurysms in ADPKD using iPSC models
GSE74666	Comparation the mRNA Expression Profile of the MV4-11 Sorafenib Resistant Cells and the Parental Cells
GSE74668	Gene Expression Profiling of IL-17A-treated Synovial Fibroblasts from the Human Temporomandibular Joint
GSE74710	Transient transfection of miR-449 family in the hepatocellular carcinoma cell line HLE
GSE74769	Differential gene expression of Andrographis paniculata and andrographolide enriched andrographis paniculata extract in liver cells
GSE74991	Isolation of human iPSC and ESC-derived mesDA progenitor cells by immunomagnetic cells sorting (MACS)
GSE75142	Activation of IL5R and CRTH2 on Human Eosinophils Elicit a Similar Molecular Response and Reveal a Synergistic Effect
GSE75425	mRNA expression profiles in decidualized and non-decidualized normal endometrial stromal cells (NESCs).
GSE75427	Expression profiles in decidualized and non-decidualized endometriotic cyst stromal cells (ECSCs) and normal endometrial stromal cells (NESCs)
GSE75934	Comparative toxicity of Aflatoxin B1, Patulin and their biosynthetic precursors: A human intestinal microarray analysis
GSE75967	Development of gene expression signature for primary epidermal neonatal keratinocytes treated with mature IL-36B cytokine
GSE76468	Identification of Novel Changes in Human Skeletal Muscle Proteome following Roux-en-Y Gastric Bypass Surgery
GSE76583	CRC cells_Aspirin treatment_48 hours_Rep8
GSE76826	Blood transcriptomic markers in patients with late-onset major depressive disorder
GSE77018	Antigen specific human conventional T cells (CD154+) or regulatory T cells (CD137+) directed agains A. fumigatus or Birch pollen lysate isolated from Birch pollen allergic patients or healthy controls.
GSE77074	Identification of new microRNA-22-5p and -199a-5p/MMP1 functional interactions in stress-induced senescent human dermal fibroblasts [mRNA]
GSE77103	Gene expression in peripheral blood mononuclear cells from healthy control and autistic infants
GSE77254	Gene expression analysis in the peripheral blood of baboons for early prediction of the later occurring hematological ARS using human Agilent SurePrint G3 Microarrays, v2 (8x60K)
GSE77407	Identification of new microRNA-22-5p and -199a-5p/MMP1 functional interactions in stress-induced senescent human dermal fibroblasts
GSE77439	Development of gene signatures of human unipotent megakaryocyte progenitor and other hematopoietic stem and progenitor populations
GSE77606	Transcriptomic analysis of human tumor cell lines
GSE77676	The Distinct Transcriptional and Metabolic Profiles Associate with Empathy in Spiritual/Religious Trained Buddhists: A Pilot Study of Shingon Esoteric Buddhism Priests
GSE77883	Enzalutamide inhibits proliferation of gemcitabine-resistant bladder cancer cells with increased androgen receptor expression
GSE77963	A Mixture Reflecting Polybrominated Diphenyl Ether (PBDE) Profiles Detected in Human Follicular Fluid Significantly Affects Steroidogenesis and Induces Oxidative Stress in a Human Granulosa Cell Line
GSE78017	The effects of RED GREEN and BLUE LED light on both human diabetic fibroblast cell lines
GSE78018	The effects of RED GREEN and BLUE LED light on human normal healthy fibroblast cell lines
GSE78020	Comparison of gene expression between Human umbilical vein endothelial cells and Human liver sinusoidal endothelial cells
GSE78095	Gene expression in amniotic menbrane-derived cells (mesenchymal stromal cells and epithelial cells) and expression signatures of these two types of cells after IL-10 stimulation
GSE78244	Gene Expression Profiling of Resting and Activated CD4+ T Cells in Patients with Multiple Sclerosis
GSE78722	RNA-microarray analyses and protein profiles from affected and clinically non-affected scalp in male androgenetic alopecia patients
GSE78765	ARPE-19_adriamycin_gene_expression
GSE78847	Analysis of cord blood B cells
GSE78850	Gene expression in human prostate cancer (PCa) cell lines upon HIC1 silencing
GSE78867	The anti-tumor core molecular targets of TSA in cholangiocarcinoma
GSE79077	Microarray analysis of human monocyte-derived macrophages stimulated with dexamethasone, interferon-gamma and dexamethasone/interferon-gamma
GSE79235	Epithelial-to-mesenchymal transition defines feedback activation of receptor tyrosine kinase signaling induced by MEK inhibition in KRAS mutant lung cancer
GSE79246	Study of transcriptional effects of drugs on SNU-423 hepatocellular carcinoma cell lines
GSE79637	Cervical lymph node metastasis high metastatic HNSCC lines vs non-metastatic HNSCC lines
GSE79759	Human embryonic stem cells vs. fibroblast-derived iPS cells
GSE79762	New non-transmissible measles virus vector for establishment of iPS cells
GSE79897	Analysis of Notch-regulated lncRNA in human glioma stem cell
GSE79991	Characterization of melanoma cells exposed to melanoma-specific CD8+ T cells
GSE80125	Treatment of extracellular vesicles change gene expression in mesothelial cells
GSE80140	Gene expression of myeloma cell lines under hypoxia
GSE80324	Expression profiling of cell growth on different layers
GSE80470	Assessing the mechanism and therapeutic potential of modulators of the human Mediator complex-associated protein kinases
GSE80471	Assessing the mechanism and therapeutic potential of modulators of the human Mediator complex-associated protein kinases
GSE80472	Assessing the mechanism and therapeutic potential of modulators of the human mediator complex-associated protein kinases
GSE80545	Gene expression of myeloma patient samples under hypoxia
GSE80754	Breast tumors: different structures of tumor cells [gene expression]
GSE80759	Breast tumors: different structures of tumor cell
GSE81310	The effect of EPO on gene expression signatures of hepatocellular carcinoma cells
GSE81360	ATM signalling and autophagy cooperate in the regulation of breast cancer stem-like phenotype: a transcriptional profile
GSE81363	Investigation of gene expression alterations of pancreatic cancer caused by Deferasirox administration
GSE81370	Rapid decay of engulfed extracellular miRNA by XRN1 exonuclease promotes transient epithelial-mesenchymal transition
GSE81746	Gene expression profiling of tuberculosis patients from India
GSE81786	Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses [expression]
GSE81798	Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses
GSE81819	Premalignant lesions of the bronchial epithelium
GSE81831	Gene expression signatures for entecavir treated HepG2.2.15 cells compared to entecavir untreated HepG2.2.15 cells
GSE81996	Transcriptomic analysis of pro-invasive fibroblasts activation short term response
GSE81997	Transcriptomic analysis of pro-invasive fibroblasts activation long term response
GSE81998	Transcriptomic analysis of pro-invasive fibroblasts activation short and long term response
GSE83215	Evaluation of the immunogenicity of live-attenuated influenza vaccines in nasal epithelial cells in primary differentiated human nasal epithelial cells [Microarray Expression]
GSE83276	Targeting metastasis stem cells through the fatty acid receptor CD36
GSE83285	Evaluation of the immunogenicity of live-attenuated influenza vaccines in nasal epithelial cells in primary differentiated human nasal epithelial cells
GSE83346	Targeting metastasis stem cells through the fatty acid receptor CD36 (DID+, DID- and CD44DIM).
GSE83367	CSB ablation induced apoptosis is mediated by Increased Endoplasmic Reticulum Stress Response: a gene expression study
GSE83386	Gene expression of Lymphoblastoid Cell Lines (LCLs) from Depressed Patients after in-vitro treatment with fluoxetine
GSE83393	Newborn Sex-specific Transcriptome Signatures and Gestational Exposure to Fine Particles: Findings from the ENVIRONAGE Birth Cohort
GSE83490	Identification of expression patterns after B2M restoration in deficient lung cancer cell lines
GSE83675	Development of gene expression signatures of ascending aorta of the patients with bicuspid aortic valve compared to tricuspid aortic valve.
GSE83836	TTF-1-regulated miR-532-5p targets KRAS and MKL2 oncogenes and induces apoptosis in lung adenocarcinoma [pts]
GSE83837	TTF-1-regulated miR-532-5p targets KRAS and MKL2 oncogenes and induces apoptosis in lung adenocarcinoma [cell line]
GSE83839	TTF-1-regulated miR-532-5p targets KRAS and MKL2 oncogenes and induces apoptosis in lung adenocarcinoma
GSE83853	Silencing miR-31 in naive CD4+ T cells by antagomiRNA
GSE83880	Gene expression of developed cancer stem cells [OCC-hiPS]
GSE83881	Gene expression of developed cancer stem cells [all]
GSE83883	Gene expression of developed cancer stem cells
GSE83902	Human Dental Pulp Cells FGF(+) vs FGF(-)
GSE84012	Implication of VSMC heterogeneity among arterial beds in vascular calcification
GSE84652	Gene expression profiling in Dip G-treated HL-60 cells
GSE84787	Human gastric cancer_Tumor samples_Paired normal samples_10 replicates
GSE84918	Gene and microRNA modulation upon ET-743 treatment in a human intrahepatic cholangiocarcinoma paired patient derived xenograft and cell line [gene expression]
GSE84939	Gene and microRNA modulation upon ET-743 treatment in a human intrahepatic cholangiocarcinoma paired patient derived xenograft and cell line
GSE85123	An Indel Polymorphism within pre-miR3131 Confers Risk for Hepatocellular Carcinoma
GSE85226	Impact of Visceral Fat Adiposity on Gene Expression Profile in Peripheral Blood Cells
GSE85235	Effects of black currant extract on gene expression on MCF10A
GSE85236	Gene expression profiling in Human mammary epithelial cell (MCF10A) by repression of KRT81 expression
GSE85257	Study of transcriptional effects of Vorinostat, Sorafenib and Resveratrol on SNU-387 and HepG2/C3A hepatocellular carcinoma cell lines
GSE85358	Metabolic alterations in aged human skin in vivo
GSE85802	LCOR regulates transcription of human mammary epithelial and breast cancer cells
GSE85803	Gene expression analysis between primary keratinocytes and primary dermal fibroblasts obtained from the same skin sample
GSE85808	miR-199a-LCOR axis regulation of mammary gland stem cell and breast cancer stem cell transcriptional programs
GSE86044	Gene expression analysis of renal cell carcinoma cell line A-498 after 3-hour treatment with englerin A.
GSE86045	Gene expression analysis of renal cell carcinoma cell line A-498 after 8-hour treatment with englerin A.
GSE86046	Gene expression analysis of renal cell carcinoma cell line A-498 after 20-hour treatment with englerin A.
GSE86047	Gene Expresion Analysis of A-498 cells after treatment with Englerin A
GSE86274	The cellular response of immortalized TRF2dB fibroblast cells by 4-hydroxytamoxifen drug treatments
GSE86293	Comparison of the lymphocyte before and after the activation.
GSE86942	RNA Splicing of the BHC80 gene Facilitates Neuroendocrine Prostate Cancer Progression
GSE86970	UNCOVERING VULVAR CARCINOMA: AN INTEGRATIVE APPROACH [GE]
GSE87047	Transcriptome profile in INT cells following Cryptosporidium parvum infection
GSE87378	Development of chemically modified peptide targeting BIG3-PHB2 interaction on estrogen-dependent breast cancer
GSE87479	Global surveillance of somatic alterations in triple negative breast cancers by whole exon sequencing analyses
GSE87551	Gene expression analysis of papillary and reticular dermis microdissected from the same skin sample
GSE87666	Gene expression profiling of human gastric tissues at different pathological stages
GSE87841	Gene expression in SAS cell lines upon SNAI1 silencing
GSE88806	Gene expression profiles for human bone marrow-mesenchymal stromal cells (hBM-MSCs)
GSE88879	Long Term Culture of the A549 Cell Line Promotes Differentiation Towards an Alveolar Type II (ATII) Phenotype; A549 Time course.
GSE88880	Long Term Culture of the A549 Cell Line Promotes Differentiation Towards an Alveolar Type II (ATII) Phenotype; Comparison of A549 cells with Primary ATII Cells
GSE88881	Long Term Culture of the A549 Cell Line Promotes Differentiation Towards an Alveolar Type II (ATII) Phenotype
GSE89039	Gene expression profiling in 8 lung cancer in Xuanwei samples
GSE89047	Gene expression profiling and copy number alterations in 8 lung cancer in Xuanwei samples
GSE89229	Comparison of gene expression profilings between parental A549, OSK-A549-Colony and OSK-A549-SN
GSE89239	The deubiquitinase USP22 stabilizes BMI1 polycomb ring finger oncoprotein to confer cancer stem cell traits and glioblastoma progression
GSE89447	The Gene Expression Study (GEP) was based on a cohort of 27 MCL cases enrolled in the Fondazione Italiana Linfomi (FIL)-MCL-0208 randomized Italian clinical trial.
GSE89615	The Gene Expression Study (GEP) was based on a 6 MCL cell line models.
GSE90064	Involvement of kallikrein-related peptidase 6 in epithelial to mesenchymal transition induced by ΔNp63 downregulation in oral squamous cell carcinoma through activation of protease activated receptors
GSE90582	Gene expression profiling of LRRC26-depleted HCC70 cells
GSE90590	Induction of SFTPC+ cells from human induced pluripotent stem cell-derived CPMhigh progenitor cells by forming alveolar organoids
GSE90591	Expansion of SFTPC+ cells from human induced pluripotent stem cell-derived CPMhigh progenitor cells by forming alveolar organoids
GSE90594	Study of gene expression alteration in male androgenetic alopecia: evidence of predominant molecular signaling pathways
GSE90617	Hazard Assessment of High-Nitrogen Compounds: Coupling Transcriptomics with Multi-Cellular Co-Culture Assays Provides Accurate Systemic Toxicity Screening [DNAN]
GSE90618	Hazard Assessment of High-Nitrogen Compounds: Coupling Transcriptomics with Multi-Cellular Co-Culture Assays Provides Accurate Systemic Toxicity Screening [TNT]
GSE90619	Hazard Assessment of High-Nitrogen Compounds: Coupling Transcriptomics with Multi-Cellular Co-Culture Assays Provides Accurate Systemic Toxicity Screening
GSE90627	A distance-related model identified PDCD6IP as a local host protective factor in colorectal cancer
GSE90645	The impact of SpiB overexpression on gene expression profile in A549 cells
GSE90708	Expression data of multi regional colorectal carcinoma
GSE90709	Methylation, expression, and SNP data of multi regional colorectal carcinoma
GSE90790	Expression data of CFC1 overexpressed neuroblastoma cell line, NGP
GSE90791	Expression data of neuroblastoma tissues, spheres and NGP cell line overexpressing CFC1
GSE90877	Identification of signaling pathways modulated by kiaa0101 in HepG2 cells
GSE92391	Global gene expression of hiPS cell derived cardiomyocytes from healthy volunteers
GSE92512	Influence of irradiated PBMCs on both ex vivo cell proliferation of natural killer cells and change in cellular property
GSE92553	Gene expression analysis following 24h siRNA-mediated knockdown of transforming growth factor β receptor III (TGFBR3) in human pulmonary arterial endothelial cells (hPAEC).
GSE92612	CNOTshRNA or Melatonin treated samples
GSE92935	Differential gene expression profiles of corneal epithelium from Keratoconus patients
GSE93408	Comparison of gene expression profilings between Mock-WS480, NonV50-OKS-SW480 and 2ndV50-OKS-SW480
GSE93793	Characterization of three Epithelial Ovarian Cancer cell lines resistant to cisplatin (mRNA).
GSE93795	Characterization of three Epithelial Ovarian Cancer cell lines resistant to cisplatin.
GSE93829	Selective Degradation of Splicing Factor CAPER-alpha by Anticancer Sulfonamides
GSE93840	Transcriptional comparisons of stem cell-derived hepatocytes (hiPS-Hep), HepaRG cells and 3D human hepatocyte spheroids as predictive in vitro systems for drug-induced liver injury
GSE93854	Adaptation of human cells to protein synthesis errors
GSE94128	Transcriptome profile in INT cells modulated by Cryptosporidium parvum RNA transcripts
GSE94861	Gene expression profiling of HepG2 cells after treatment with Brefeldin A
GSE94931	Gene expression changes in primary GBM neurosphere cultures after 24 hours of CDK7 inhibition
GSE95187	Application of the TGx-28.65 genomic biomarker to assess the genotoxicity of disperse orange and 1,2,4-benzenetriol in human cells [DO]
GSE95188	Application of the TGx-28.65 genomic biomarker to assess the genotoxicity of disperse orange and 1,2,4-benzenetriol in human cells [BT]
GSE95192	Application of the TGx-28.65 genomic biomarker to assess the genotoxicity of disperse orange and 1,2,4-benzenetriol in human cells
GSE95272	Prominent oncogenic roles of EVI1 in breast carcinoma
GSE95698	Development of gene expression signatures of GPCR family.
GSE96734	100mM ethanol vs. control for 72hr for human esophageal squamous epithelial cells (KYSE510)
GSE96754	Endosteal Niche E-selectin Induces Mesenchymal-Epithelial Transition and Wnt Activation in Cancer Cells to Promote Bone Metastasis
GSE96858	Gene expression of myeloma cell line (U266) transduced with Scr or shKDM3A cultured in normoxia or hypoxia
GSE96888	Interleukin-7 induced transcriptome differences of CD4+ T cells with or w/o additional T cell activation (TCA)
GSE96943	Expression analysis of A549 cells following treatment with conditioned medium from polarized macrophages
GSE97000	Peripheral blood lymphocytes with different levels of gH2AX foci and micronuclei
GSE97175	Expression data from A549 cells after treatment with bradykinin
GSE97368	Gene expression profiling of low-dose irradiated human BM-MSCs
GSE97823	Impact of DNM3OS silencing on human lung fibroblast response to TGF-β
GSE97824	Impact of miR-199-5p, miR-199a-3p and miR-214-3p overexpression on human lung fibroblasts
GSE97833	TGF-β signature of MRC-5 fibroblasts
GSE97834	The DNM3OS lncRNA is a reservoir of fibromiRs with major functions in fibroblast response to TGF-beta and fibrogenesis
GSE98090	Identification of a human clonogenic progenitor with strict monocyte differentiation potential - a counterpart of mouse cMoPs
GSE99053	Ribosome Incorporation into Somatic Cells Promotes Lineage Transdifferentiation towards Multipotency [Array]
GSE99089	Ribosome Incorporation into Somatic Cells Promotes Lineage Transdifferentiation towards Multipotency
GSE99289	Human AsPC1-CFP and AsPC1-AKT PDAC orthotopic tumors: Lean vs Obese
GSE99507	Tinagl1 Suppresses Triple-negative Breast Cancer Progression by Simultaneously Targeting Integrin/FAK and EGFR Signaling Pathways
GSE99725	Transcriptomic Signaling Pathways involved in a naturalistic model of Inflammation-related Major Depressive Disorder and its remission
GSE99939	Drug toxicology models by using hiPSC-derived alveolar organoids (AOs)
GSE100374	HIV-1 infection of human monocyte-derived dendritic cells with and without the integrase inhibitor, Raltegravir (gene expression).
GSE100377	HIV-1 infection of human monocyte-derived dendritic cells with and without the integrase inhibitor, Raltegravir
GSE100433	Identification of gene signature in human colorectal CD44+ cancer stem cells
GSE100927	Atherosclerotic and control peripheral artery gene expression
GSE101043	Overexpression of nuclear receptor 5A1 induces and maintains an intermediate state of conversion between primed and naive pluripotency
GSE101089	Overexpression of nuclear receptor 5A1 induces and maintains an intermediate state of conversion between primed and naive pluripotency
GSE101640	Human Prostate Cancer Cells: ISL-treated cells vs. Control
GSE102109	TGF-beta signature in cholangiocarcinoma cell lines
GSE102110	CASC15 overexpression in HuCCT1 cholangiocarcinoma cell line
GSE102122	Genome-Scale Transcriptional Regulatory Network Models of Psychiatric and Neurodegenerative Disorders
GSE102129	LiCl treated KG1a cells, irradiated at 4Gy and 8Gy, incubated for 48hr
GSE102165	Human HCT-116 cells: Control vs CDK2 knockout, NU6102 treated and resistant cells
GSE102304	Differentially expressed genes related to inflammatory disease on nasal cavity induced by diesel exhaust particles (DEPs)
GSE102613	Depletion of ZNF185 causes delay of keratinocyte differentiation
GSE103049	The effect of anti-S100A11 antibody on cell growth of MPM cell lines
GSE103085	Divergent lncRNA MYMLR regulates MYC by eliciting DNA looping and promoter-enhancer interaction
GSE103889	Gene Expression Profiling of Whole Blood: A Comparative Assessment of RNA-Stabilizing Collection Methods
GSE103890	Silencing of ultra-conserved long non-coding RNA Uc.291 causes delay of keratinocyte differentiation
GSE104601	Investigating the effect of inflammatory conditions on acetaminophen-induced liver injury using 3D human multicellular microtissues
GSE104662	ARPE-19 adriamycin gene expression II
GSE104742	Gene expressions of human macrophages and oligodendrocytes
GSE106465	Massive and reproducible production of liver buds entirely from human pluripotent stem cells
GSE107101	Transcriptomic analysis and mutational status of IDH1 in paired primary-recurrent intrahepatic cholangiocarcinoma [Agilent]
GSE107102	Transcriptomic analysis and mutational status of IDH1 in paired primary-recurrent intrahepatic cholangiocarcinoma
GSE107354	Alteration of treatment of the ALK inhibitor in ALK-amplified neuroblastoma
GSE107438	25D3 and 1,25D3 target gene profiles in LNCaP
GSE107914	Increased AIF-1-mediated TNF-α expression during the implantation phase in IVF cycles with GnRH antagonist protocol
GSE108214	Key players of cisplatin resistance: towards a systems pharmacology approach
GSE108324	Gene expression analysis to find molecular mechanisms underlying the role of miR-342-5p in HER2 breast cancer
GSE108719	Gene expression of Myeloid cells stimulated with cytokines.
GSE108720	Gene expression of human hematopoietic stem cells (CD34+) stimulated with native & mutant (244) form of myeloid stem-cell transcription factor PU.1 alone & in combination with myeloid specific cytokines (IL3+GMCSF+Flt2+MCSF+SCF)
GSE108937	Human iPSC derived posterior gut progenitors are expandable and capable of forming gut and liver organoids
GSE109749	Transcriptional response of HT-29 intestinal epithelial cells to bovine glycomacropeptide.
GSE110230	Transcriptome data from human Th17, classic Th1 and non-classic Th1 cell clones
GSE110852	Gene expression profiles of subjects exposed to Arsenic through drinking water in Pakistan
GSE111597	Gene-expression analysis of human embryonic stem cell (HESC-)- derived rosette-forming neural progenitor cells (NPCs) in the presence of lysophosphatidic acid (LPA)
GSE111680	Gene expression in ATN1-1 cells with or without coculture with macrophages
GSE111827	Development of gene expression signatures for the A549 cells that overexpressed of FOSB
GSE111885	Molecular mechanisms and potential therapeutic drugs linking to cetuximab-induced reactions in human cells (HaCaT cells)
GSE111886	Molecular mechanisms and potential therapeutic drugs linking to cetuximab-induced reactions in human cells (HEK 293 cells)
GSE111887	Molecular mechanisms and potential therapeutic drugs linking to cetuximab-induced reactions in human cells
GSE111946	microRNA-218 modulates gene expression in fibroblast-like synovial cells in rheumatoid arthritis
GSE111974	Endometrial Tissue RNA expression in Recurrent Implantation Failure vs. Conrol
GSE111994	Development of gene expression signatures for lenalidomide treatement on megakaryocyte
GSE112644	LiCl and Bax Antagonist Peptide (BAP) treated KG1a cells, irradiated at 4Gy and 8Gy, incubated for 48hr
GSE112758	Gene expression of nucleolin or TRA2B4-silencing HCT116 cells
GSE112988	Gene expression profiles of A549 lung cancer cells with citreoviridin treatment
GSE113212	The hypertrophy of the ligamentum flavum is assosciated with activation of the unfolded protein respone
GSE113395	Investigating Gene expression profiles of whole blood and peripheral blood mononuclear cells using multiple methods
GSE113533	Gene expression analysis of cancer stem cells with stem cells or cancer related cells
GSE114097	The global gene expression profiling of the earliest phase of the differentiation of human embryonic stem cells into classical brown adipocytes
GSE114169	Effect of an Analgesic Drug on Necelus Pulposus Cells from Human Intervertebral Disc (IVD) Tissues
GSE114227	Gene expression profile of HeLa cells with stable inducible expression of DOCK10
GSE114243	The role of DOCK10 in the regulation of the transcriptome and aging
GSE114362	Autocrine Motility Factor Modulates Proliferation Signaling Mediated By GPER
GSE114681	Gene expression of 5-azacytidine-treated HCT116 cells
GSE114841	Gene expression in human macrophages stimulated with IFN-alpha and IL10
GSE114928	Molecular mechanisms and potential therapeutic drugs linking to cetuximab-resistance reactions in cancer cells
GSE115738	Expression profile of immortalized mesothelial cells with or without activated TAZ
GSE115812	Comparing Gene Expression Profiling of ATO sensitive and Resistant cell lines
GSE116280	Acute and delayed transcriptomics changes in 3D LUHMES exposed to rotenone
GSE116677	Transcriptomic regulation of human mesenchymal stem cells in delivering anti-tumorigenic effects on leukaemic cell lines
GSE116742	Analysis of lncRNAs for the characterization of the response to neoadjuvant chemoradiotherapy
GSE116959	Transcriptome profiling of 57 LUAD samples and 11 peritumoral normal lung tissues
GSE117036	Impact of NLUCAT1 deletion on A549 cells in normoxic and hypoxic conditions
GSE117041	Hypoxic transcriptomic signature of A549 cells (Agilent microarrays)
GSE117049	The nuclear hypoxia-regulated NLUCAT1 long non-coding RNA contributes to an aggressive phenotype in lung adenocarcinoma through regulation of oxidative stress
GSE117285	Pattern of Extramammary Paget disease gene expression
GSE117583	Gene expression profiling of HepG2 cells treated with hawk tea extracts vs. DMSO-treated control group
GSE118227	iPS derived melanocyte precursor cells
GSE118887	Non-coding RNA, RNY1 is essential for reprogramming process
GSE119468	Gene expression analysis of glioblastoma (GBM) cell lines.
GSE119637	Multi-level characterization of a glioblastoma cell line panel
GSE119671	Expression data from knockdown of HSD3B1 in MDA-MD-231 breast cancer cell line
GSE120270	Gene expression profiling of the cancer stem cells of cervical cancer vs the bulk population
GSE120713	Ikarugamycin blocks the glycolysis in pancreatic cancer
GSE120772	Gene expression patterns of trisomy 12 hPSC lines
GSE121528	Direct Targeting of MYCN Gene Amplification by Alkylating Pyrrole-Imidazole Polyamide in Neuroblastoma Cells (CHP-134)
GSE121529	Direct Targeting of MYCN Gene Amplification by CRISPR/Cas9 in Neuroblastoma Cells (CHP-134)
GSE121530	Direct Targeting of MYCN Gene Amplification by Alkylating Pyrrole-Imidazole Polyamide and CRISPR/Cas9 in Neuroblastoma Cells (CHP-134)
GSE123014	Gene expression signatures associated with PI3Kα-induced senescence
GSE123108	Exploring gene expression signatures of itraconazole for infantile hemangioma endothelial cell in vitro
GSE123313	Characterization of microRNA-493-5p targets in liver cell lines
GSE123402	Systematic transcriptome analysis of white tea based on microarray
GSE124478	Gene expression of human colon cancer HCT116 cells [HOXA5_OE]
GSE124479	Gene expression of human colon cancer HCT116 cells [HOXA5_si]
GSE124480	Gene expression of human colon cancer HCT116 cells
GSE124987	Bone marrow microenvironment mediated drug resistance in Acute promyelocytic leukemia
GSE125094	Manifestations of gene expression profiles in human right atrial myocardium caused by mechanical stretch
GSE125407	Characterization of microRNA-493-5p targets in liver cell lines (2nd set of data)
GSE125519	GPCR-induced YAP activation sensitizes fibroblasts to profibrotic effects of TGFβ1
GSE126161	Assessment of the effect of RNase A-treated Enterococcus feacalis strain EC-12(EC-12) or untreated EC-12 on transcriptome profiles in human peripheral blood mononuclear cells
GSE127069	RNA sequencing for cancer tissues and adjacent tissues of third-stage rectal cancer patients with and without blood vascular thrombus
GSE127200	Gene expression data from sorted primary human acute myeloid leukemia (AML) samples
GSE127761	Analysis of gene expression signatures for primary vitreo retinal lymphoma
GSE128381	A co-expression analysis of the placental transcriptome in association with maternal pre-pregnancy BMI and newborn birth weight
GSE128539	The impact of Pax5 overexpression on gene expression profile in A549 cells
GSE128600	Late recurrence-associated long non-coding RNA NR2F1 antisense 1 (NR2F1-AS1)
GSE128788	Gene expression analysis on the immortalized human mesothelial cell lines with different morphologies.
GSE128965	Long noncoding RNA ELIT-1 acts as a Smad3 cofactor to facilitate TGF-β/Smad signaling and promote epithelial-mesenchymal transition
GSE129008	Long noncoding RNA ELIT-1 acts as a Smad3 cofactor to facilitate TGF-β/Smad signaling and promote epithelial-mesenchymal transition
GSE129247	Down-regulation of atherosclerosis signaling in patients treated with on-line haemodiafiltration may contribute to lower cardiovascular risk in hemodialysis
GSE130071	NUGC3 cells treated with siVGLL1
GSE130328	Microarray analysis of the effect of shRNA-mediated HAVCR2 knock-down (KD) in TIM-3-positive AML cell line, KASUMI-3
GSE130823	Dissecting Expression Profiles of Gastric Precancerous Lesions and Early Gastric Cancer to Explore Crucial Molecules in Intestinal-type Gastric Cancer Tumorigenesis
GSE131372	Gene expression of blood cells in a patient with GATA2 deficiency.
GSE131518	Analysis of gene expression in CNOT2-depleted A549 lung cancer cells
GSE131539	Characterization of SFPQ role in ovarian cancer cell lines
GSE131802	Histone Hypoacetylation Impairs the Plasticity of Human Hepatocytes with Aging [Fig1, FigS1 and Fig3]
GSE131803	Histone Hypoacetylation Impairs the Plasticity of Human Hepatocytes with Aging [Fig4]
GSE131805	Histone Hypoacetylation Impairs the Plasticity of Human Hepatocytes with Aging [FigS3]
GSE131806	Histone Hypoacetylation Impairs the Plasticity of Human Hepatocytes with Aging
GSE133134	Human breast cancer cells and cancer-associated fibroblasts: Control vs. Compressed
GSE133339	The zingerone analog, acetyl zingerone, bolsters matrisome synthesis, inhibits MMPs, and represses IL-17A target gene expression [Experiment 2]
GSE133340	The zingerone analog, acetyl zingerone, bolsters matrisome synthesis, inhibits MMPs, and represses IL-17A target gene expression
GSE134499	Comparative analysis of gene expression profiles comparing radioresistant to radiosensitive prostate cancer cell lines
GSE134500	DNA copy number alteration analysis and gene expression profiles comparing radioresistant to radiosensitive prostate cancer cell lines
GSE134929	Identification of ISG20 as the nuclease involved in interferon-induced decline of hepatitis B virus cccDNA
GSE135011	Long-term maintenance of functional primary human hepatocytes using small molecules
GSE135652	Gene expression of fibroblasts carrying SAMHD1 mutations or not
GSE136412	Observation of the Changes in Chemokine-related Gene Expression of Endometriotic Cyst Stromal Cells by Three-dimensional Collagen Gel Culture
GSE136755	Driver gene alterations and activated signaling pathways toward malignant progression of gastrointestinal stromal tumors
GSE136924	Gene profile in ovarian cancer cell spheroids
GSE137024	Gene expression study in SF3B1-mutated, NOTCH1-mutated and WT CLL cells
GSE137684	Differential messenger RNA expression in Granulosa Cells from polycystic ovary syndrome with Normoandrogen and Hyperandrogen: Identification of gene sets through bioinformatic Filtering analysis
GSE137886	Osteoprotegrin induced expression in human pulmonary artery smooth muscle cells
GSE137919	RHAMM marks proliferative subpopulation within CD44+ human colorectal cancer stem cells
GSE139954	Gene expression profiles of miR-100-5p-transfected normal endometrial stromal cells
GSE140858	BRD4 promotes metastatic potential in oral squamous cell carcinoma through the epigenetic regulation of the MMP2 gene
GSE140880	Angiogenic Transformation in Human Brain Micro Endothelial Cells: Whole Genome DNA Methylation and Transcriptomic Analysis
GSE140962	Correlating functional heterogeneity of human dermal fibroblasts with differences in gene expression
GSE142708	Transcriptional response to IFN-κ and IFN-κDual in A549 cell line
GSE142709	IFN-kappa Suppresses the Replication of Influenza A Virus through IFNAR-MAPK-Fos-CHD6 Axis
GSE142816	Microarray gene expression analysis of HNSCC- and BM- derived mesenchymal stromal cells
GSE144089	Fc receptor-like 4 (FCLR4) and Fc receptor-like receptor 5 (FCRL5) define and control human atypical memory B cells [array]
GSE144096	Identification of novel activation marker and regulator of human basophils via transcriptomic analysis of IL-3-stimulated basophils
GSE145520	Fc receptor-like 4 (FCLR4) and Fc receptor-like receptor 5 (FCRL5) define and control human atypical memory B cells
GSE145589	Assessment of gene expression changes in ex vivo-expanded human skin-derived ABCB5-selected mesenchymal stem cells during passaging
GSE145599	The function and mechanism about how ORAOV1-B potentiates the OSCC metastasis.
GSE146483	Development of gene expression signatures for oral cancer
GSE146587	Gene expression in stage III colorectal cancer
GSE146698	Differential gene expression analysis between adherent U87MG cells and U87MG cell-derived glioma stem-like cells (P4E8 cells).
GSE147549	Transcriptomic profiling of human pancreatic cancer-derived cell lines MiaPACA-2 depleted of TRIP12 mRNA compared to control cells
GSE147717	Transcriptomic profiling of human pancreatic cancer-derived cell lines PANC-1 depleted of TRIP12 mRNA compared to control cells
GSE148601	mRNA expression analysis of several cell subset from peripheral blood of SLE patient and Healthy Control
GSE148795	Study of transcriptional effects of FOXS1 silencing and TGF-beta treatment in SNU-449 hepatocellular carcinoma cell line
GSE148847	Gene expression profiling of MDA-MB-231 cells transfected with hsa-miR-205-5p and hsa-miR-214-3p compared to scrambled miRNA precursors
GSE148848	microRNA expression profiling of paired primary and lymph node metastatic breast cancer patients, and gene expression profiling of MDA-MB-231 cells transfected with hsa-miR-205-5p and hsa-miR-214-3p compared to scrambled miRNA precursors
GSE148913	Transcriptomic profiling of human pancreatic cell lines hPNE/hTert stably over-expressing DNMTs compared to GFP-hPNE/hTert over-expressing control cells after lentiviral transduction
GSE149228	Comparison of the hepatic effects of phenobarbital in chimeric mice containing either rat or human hepatocytes with humanized constitutive androstane receptor (CAR) and pregnane X receptor (PXR) mice (hCAR/hPXR mice) [chimeric humanized liver experiments]
GSE149980	Gene expression of Lymphoblastoid Cell Lines–LCLs from Depressed Patients after in-vitro treatment with citalopram–CTP
GSE151198	Transcriptome profiling of SUM159 and derivatives with different metastasis capability
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Relations

Alternative to

GPL16699

Data table header descriptions
ID	Agilent Probe Name
SPOT_ID	Spot identifier
CONTROL_TYPE	Control type
REFSEQ	RefSeqAccession
GB_ACC	GenBank Accession number
LOCUSLINK_ID	LocuslinkID
GENE_SYMBOL	Gene Symbol
GENE_NAME	Gene Name
UNIGENE_ID	UnigeneID
ENSEMBL_ID	EnsemblID
ACCESSION_STRING	Accession String
CHROMOSOMAL_LOCATION	Chromosomal Location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Sequence

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

LOCUSLINK_ID

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

GE_BrightCorner

CONTROL

pos

DarkCorner

CONTROL

pos

A_23_P117082

FALSE

NM_015987

50865

HEBP1

heme binding protein 1

Hs.642618

ENST00000014930

ref|NM_015987|ens|ENST00000014930|gb|AF117615|gb|BC016277

chr12:13127906-13127847

hs|12p13.1

Homo sapiens heme binding protein 1 (HEBP1), mRNA [NM_015987]

AAGGGGGAAAATGTGATTTGTGCCTGATCTTTCATCTGTGATTCTTATAAGAGCTTTGTC

A_33_P3246448

FALSE

NM_080671

23704

KCNE4

potassium voltage-gated channel, Isk-related family, member 4

Hs.348522

ENST00000281830

ref|NM_080671|ens|ENST00000281830|tc|THC2655788

chr2:223920197-223920256

hs|2q36.1

Homo sapiens potassium voltage-gated channel, Isk-related family, member 4 (KCNE4), mRNA [NM_080671]

GCAAGTCTCTCTGCACCTATTAAAAAGTGATGTATATACTTCCTTCTTATTCTGTTGAGT

A_33_P3318220

FALSE

NM_178466

128861

BPIFA3

BPI fold containing family A, member 3

Hs.360989

ENST00000375454

ref|NM_178466|ens|ENST00000375454|ens|ENST00000471233|tc|THC2478474

chr20:31812208-31812267

hs|20q11.21

Homo sapiens BPI fold containing family A, member 3 (BPIFA3), transcript variant 1, mRNA [NM_178466]

GO:0005576(extracellular region)|GO:0008289(lipid binding)

CATTCCATAAGGAGTGGTTCTCGGCAAATATCTCACTTGAATTTGACCTTGAATTGAGAC

A_33_P3236322

FALSE

AK128005

100129869

LOC100129869

uncharacterized LOC100129869

gb|AK128005|tc|THC2484382

chr20:56533874-56533815

hs|20q13.32

Homo sapiens cDNA FLJ46124 fis, clone TESTI2040372. [AK128005]

ATTTATTTTCACAAGTGCATAGCGGCCAACACCACCAGCACTAACCAGAGTGGATTCTTG

A_33_P3319925

FALSE

XM_001133269

730249

IRG1

immunoresponsive 1 homolog (mouse)

Hs.160789

ENST00000449753

ens|ENST00000449753|ens|ENST00000377462|ref|XM_001133269|ref|XM_003403661

chr13:77532009-77532068

hs|13q22.3

immunoresponsive 1 homolog (mouse) [Source:HGNC Symbol;Acc:33904] [ENST00000449753]

GO:0019543(propionate catabolic process)|GO:0032496(response to lipopolysaccharide)|GO:0047547(2-methylcitrate dehydratase activity)

AGAAGACCTAGAAGACTGTTCTGTGTTAACTACACTTCTCAAAGGACCCTCTCCACCAGA

A_21_P0000509

FALSE

NR_024244

SNAR-G2

small ILF3/NF90-associated RNA G2

Hs.717308

ref|NR_024244

chr19:49534993-49534934

hs|19q13.33

Homo sapiens small ILF3/NF90-associated RNA G2 (SNAR-G2), small nuclear RNA [NR_024244]

AGGGGAGGGTTCGAGGGTACGAGTTCGAGGCCAACCGGGTCCACATTGGTTGAGAAAAAA

A_21_P0000744

FALSE

NR_038269

LOC100506844

uncharacterized LOC100506844

Hs.90286

ENST00000551421

ref|NR_038269|ens|ENST00000551421|ens|ENST00000546580|ens|ENST00000553102

chr12:58329728-58329669

hs|12q14.1

Homo sapiens uncharacterized LOC100506844 (LOC100506844), non-coding RNA [NR_038269]

AGTCGTACCCTCTTGTTTTTCTCTGAGTCAGTCTTAAGGTGAAATGAAGTGTGGCCCAGT

A_24_P215804

FALSE

NM_016951

51192

CKLF

chemokine-like factor

Hs.15159

ref|NM_016951|ref|NM_181641|ref|NM_181640|ref|NM_016326

chr16:66599900-66599959

hs|16q21

Homo sapiens chemokine-like factor (CKLF), transcript variant 1, mRNA [NM_016951]

AAAGAAGTTTTGTAATTTTATATTACTTTTTAGTTTGATACTAAGTATTAAACATATTTC

A_23_P110167

FALSE

NM_002413

4258

MGST2

microsomal glutathione S-transferase 2

Hs.81874

ref|NM_002413|ref|NM_001204368|ref|NM_001204366|ref|NM_001204367

chr4:140625256-140625315

hs|4q31.1

Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant 1, mRNA [NM_002413]

AATATCTGGACCTCAATATTGCCAAGAAACTGAGGCGGCAATTCTAACTTTTTCTCTTCC

A_33_P3211513

FALSE

NM_001162407

1195

CLK1

CDC-like kinase 1

Hs.433732

ENST00000357369

ref|NM_001162407|ref|NM_004071|ref|NR_027855|ens|ENST00000357369

chr2:201726021-201725962

hs|2q33.1

Homo sapiens CDC-like kinase 1 (CLK1), transcript variant 2, mRNA [NM_001162407]

AAGTAGTTATAAAAGCAAACACAGGATTCACCACAGTACTTCACATCGTCGTTCACATGG

A_23_P103349

FALSE

NM_022375

10896

OCLM

oculomedin

Hs.679230

ref|NM_022375|gb|BC069096|gb|AF142063|tc|THC2484909

chr1:186370135-186370194

hs|1q31.1

Homo sapiens oculomedin (OCLM), mRNA [NM_022375]

GO:0007601(visual perception)

GTGTATATTATAGCTGCATTGCAGGTTTCAGGATTTGCAGGGTATGGGGATGTATCCACC

A_32_P61480

FALSE

NR_026941

255082

CASC2

cancer susceptibility candidate 2 (non-protein coding)

Hs.89387

ref|NR_026941|gb|AJ535620|gb|BC112326|gb|AJ344228

chr10:119859230-119859289

hs|10q26.11

Homo sapiens cancer susceptibility candidate 2 (non-protein coding) (CASC2), transcript variant 3, non-coding RNA [NR_026941]

TAATTACTTATATTGATGTTCTTCCTACGTCTAAGAAAAATGTTATTTCCATTCCCAAGA

A_33_P3788124

FALSE

NR_026646

791114

PWRN1

Prader-Willi region non-protein coding RNA 1

Hs.720900

ref|NR_026646|gb|AK058147|gb|BC034815|tc|NP1154364

chr15:24832860-24832919

hs|15q11.2

Homo sapiens Prader-Willi region non-protein coding RNA 1 (PWRN1), non-coding RNA [NR_026646]

CTTTTGAGCCACTAAGCTACATGGTAATAGGCTATGCTTCAATAAACAATAATACACTTG

A_33_P3414202

FALSE

NM_001170704

55796

MBNL3

muscleblind-like 3 (Drosophila)

Hs.105134

ref|NM_001170704|ref|NM_018388|ref|NM_001170701|ref|NM_001170702

chrX:131516295-131516236

hs|Xq26.2

Homo sapiens muscleblind-like 3 (Drosophila) (MBNL3), transcript variant 6, mRNA [NM_001170704]

ATGATGCACGGTGCTACACCTACCACTGTGTCTGCAGCAACAACACCTGCCACCAGCGTT

A_33_P3316686

FALSE

NM_016230

51167

CYB5R4

cytochrome b5 reductase 4

Hs.5741

ENST00000369679

ref|NM_016230|ens|ENST00000369679|ens|ENST00000369681|gb|CU692982

chr6:84618749-84618808

hs|6q14.2

Homo sapiens cytochrome b5 reductase 4 (CYB5R4), mRNA [NM_016230]

GAATCCATGCTGAAAGAATGCCTGGTTGGCAGAATGGCCATTAAACCTGCTGTTCTGAAA

A_33_P3300975

FALSE

NM_014620

3221

HOXC4

homeobox C4

Hs.549040

ENST00000430889

ref|NM_014620|ref|NM_153633|ens|ENST00000430889|gb|BC050442

chr12:54449755-54449814

hs|12q13.13

Homo sapiens homeobox C4 (HOXC4), transcript variant 1, mRNA [NM_014620]

GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0005634(nucleus)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0007275(multicellular organismal development)|GO:0009952(anterior/posterior pattern formation)|GO:0043565(sequence-specific DNA binding)|GO:0048562(embryonic organ morphogenesis)|GO:0051216(cartilage development)

TAGTGTCGATGTGAAATGCCCCGTGATCAATAATAAACCAGTGGATGTGAATTAGTTTTA

A_33_P3263061

FALSE

NM_016282

50808

AK3

adenylate kinase 3

Hs.493362

ref|NM_016282|ref|NM_001199852|ref|NM_001199854|ref|NM_001199856

chr9:4711217-4711158

hs|9p24.1

Homo sapiens adenylate kinase 3 (AK3), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_016282]

TGCTGCCTGATGTCTCAATGGCTTCTGAATGACTGTTCTAATAAATGATCTTAAAACAGT

A_33_P3261373

ens|ENST00000319813|tc|NP511499

FALSE

ENST00000319813

ens|ENST00000319813|tc|NP511499

chr11:48387097-48387038

hs|11p11.2

olfactory receptor, family 4, subfamily C, member 5 [Source:HGNC Symbol;Acc:14702] [ENST00000319813]

GAAAAATGCCATGAAGCAGCTCTGGAGCCAAATAATCTGGGGTAACAATTTGTGTGATTA

Total number of rows: 50739

Table truncated, full table size 27046 Kbytes.

Download family	Format
SOFT formatted family file(s)	SOFT
MINiML formatted family file(s)	MINiML

Supplementary data files not provided