GEO Profile Links for Gene (Select 241159) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 476

<< First< Prev

Page of 24

Next >Last >>

Select item 1304468981.

Neu4 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P507709 (ID_REF), GDS5666, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130446898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 59554632.

Neu4 - High fat diet effect on aorta: time course

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL891, 6163 (ID_REF), GDS735, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5955463

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63287633.

Neu4 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL891, 6163 (ID_REF), GDS775, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6328763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092350404.

Neu4 - Diabetic db/db heart response to rosiglitazone

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL4134, 25140 (ID_REF), GDS4990, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109235040

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824766665.

Neu4 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2716254 (ID_REF), GDS3720, NM_173772

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82476666

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 680118846.

Neu4 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2716254 (ID_REF), GDS3786, NM_173772

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68011884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249515637.

Neu4 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL891, 6163 (ID_REF), GDS2078, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24951563

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 680118858.

Neu4 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2605810 (ID_REF), GDS3786, NM_173772

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68011885

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 680118869.

Neu4 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2686167 (ID_REF), GDS3786, NM_173772

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68011886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4175899910.

Neu4 - Sickle cell anemia model: brain response to naloxone

Annotation:: Neu4, Sialidase 4

Organism:: Mus musculus

Reporter:: GPL4464, 82a12 (ID_REF), GDS2826, AI850213

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 41758999

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12258518611.

Neu4 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2686167 (ID_REF), GDS5341, NM_173772

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122585186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11675145112.

Neu4 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2716254 (ID_REF), GDS5185, NM_173772, NEU4 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116751451

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13164009813.

Neu4 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P507709 (ID_REF), GDS5818, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131640098

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4417186314.

Neu4 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL891, 6163 (ID_REF), GDS2924, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44171863

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747034815.

Neu4 - MPSS transcriptome analysis project

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAACAGTCACATGCC (ID_REF), GDS868, NM_173772

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7470348

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3018621716.

Neu4 - High and low weight gainers: hypothalamus

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL2995, 838866 (ID_REF), GDS2320, NM_173772

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30186217

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3187569017.

Neu4 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL2872, 1290 (ID_REF), GDS2413, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31875690

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8247666718.

Neu4 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2605810 (ID_REF), GDS3720, NM_173772

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82476667

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6258520319.

Neu4 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL6333, scl00241159.1_279-S (ID_REF), GDS3621, NM_173772, Neu4 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62585203

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11967589820.

Neu4 - High-fat diet effect on obesity-resistant NAG-1 transgenics: colon epithelium

Annotation:: Neu4, sialidase 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P507709 (ID_REF), GDS5264, NM_173772, A_51_P507709 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 119675898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 24

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 241159) (476)
GEO Profiles
Mus musculus
Mus musculus
Mus musculus Raw sequence reads

BioProject

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 476

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity