NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6103 Query DataSets for GPL6103
Status Public on Dec 13, 2007
Title Illumina mouseRef-8 v1.1 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The MouseRef-8 v1.1 Expression BeadChip contains eight arrays for eight samples. BeadChip content was created by combining proven sources, including the Mouse Exonic Evidence Based Oligonucleotide (MEEBO) set, the RIKEN FANTOM 22-5 database, and the National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date Nov 08, 2007
Last update date Jan 18, 2013
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (1369) GSM270976, GSM270977, GSM270978, GSM270979, GSM270980, GSM270981 
Series (68)
GSE10721 Differential gene expression in murine neural stem cells (NS5) and neural stem cell-derived astrocytes
GSE10745 HDAC Inhibitors Correct Frataxin Deficiency in a Friedreich Ataxia Mouse Model
GSE11845 Resveratrol Diet Aging (Heart, Liver, Muscle and Fat Tissue)

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome built
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC
SPOT_ID

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC SPOT_ID
ILMN_2674533 Mus musculus RefSeq scl54150.7.1_69 ILMN_216726 RENBP NM_023132.2 NM_023132.2 19703 51871122 NM_023132.2 Renbp NP_075621.2 5720332 S 1329 CTCCTCGCCCGCTGTCTCTACCCATGAAGGCTCGAAATAAAGATGACCCT X - 70174848-70174858:70174859-70174897 Mus musculus renin binding protein (Renbp), mRNA. N-acetylglucosamine metabolism [goid 6044] [evidence IMP]; mannose metabolism [goid 6013] [evidence IEA] N-acylglucosamine 2-epimerase activity [goid 50121] [evidence IMP]; protein binding [goid 5515] [evidence TAS]; isomerase activity [goid 16853] [evidence IEA]; mannose-6-phosphate isomerase activity [goid 4476] [evidence IEA] scl54150.7.1_69-S-10 NM_023132.2
ILMN_1230479 Mus musculus MEEBO scl0013846.2_9 ILMN_217164 EPHB4 scl0013846.2_9 NM_010144.2 31560595 NM_010144.2 Ephb4 2480037 S 3698 GTTCTAGAACAGTGCCTTGGAAATGCCACAGCCTTAGACAGTTCCCCGGA scl0013846.2_9-S-1 NM_010144.2
ILMN_2592844 Mus musculus MEEBO scl0013142.1_12 ILMN_209132 DAO1 scl0013142.1_12 NM_010018.1 6753601 NM_010018.1 Dao1 60056 S 670 ACAACTCTCCGTACATCATCCCAGGTTCCAAGACAGTTACACTCGGAGGT scl0013142.1_12-S-3 NM_010018.1
ILMN_2619826 Mus musculus RefSeq scl0001901.1_31 ILMN_241259 ALG3 NM_145939.1 NM_145939.1 208624 22122364 NM_145939.1 Alg3 NP_666051.1 7100131 S 765 CCCCATTGGCTACCTATCCCGCTCCTTTGACCTTGGTCGTCAGTTTCTTT 16 - 20520426-20520475 Mus musculus asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) (Alg3), mRNA. membrane [goid 16020] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA] transferase activity, transferring glycosyl groups [goid 16757] [evidence IEA]; transferase activity [goid 16740] [evidence IEA]; mannosyltransferase activity [goid 30] [evidence IEA] D16Ertd36e; MGC36684 scl0001901.1_31-S-2 NM_145939.1
ILMN_1215893 Mus musculus RefSeq scl0001901.1_31 ILMN_241259 ALG3 NM_145939.1 NM_145939.1 208624 22122364 NM_145939.1 Alg3 NP_666051.1 2650647 S 1181 TTGAGCTCTCCTGGAATACGTACCCATCCACGTCCTTCAGCTCTGCCGCC 16 - 20519190-20519239 Mus musculus asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) (Alg3), mRNA. membrane [goid 16020] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA] transferase activity, transferring glycosyl groups [goid 16757] [evidence IEA]; transferase activity [goid 16740] [evidence IEA]; mannosyltransferase activity [goid 30] [evidence IEA] D16Ertd36e; MGC36684 scl48662.9.1_15-S-1 NM_145939.1
ILMN_1250986 Mus musculus RefSeq NM_178786.2 ILMN_210447 9530098N22RIK NM_178786.2 NM_178786.2 320640 31341839 NM_178786.2 9530098N22Rik NP_848901.1 5290138 S 3898 GCAGGGGACAGGTGATGGGTTAGGGGATTTTGTGGGTAGAGAACTGGGAA 4 + 111665909-111665958 Mus musculus RIKEN cDNA 9530098N22 gene (9530098N22Rik), mRNA. scl00320640.2_299-S-1 NM_178786.2
ILMN_2777265 Mus musculus RefSeq NM_178786.2 ILMN_210447 9530098N22RIK NM_178786.2 NM_178786.2 320640 31341839 NM_178786.2 9530098N22Rik NP_848901.1 2360372 S 1521 GACAGATATTTCAATGATTTTAGGATTTCTATTGTCAATTTTCATTGTTA 4 + 111655962-111656011 Mus musculus RIKEN cDNA 9530098N22 gene (9530098N22Rik), mRNA. scl0320640.10_8-S-10 NM_178786.2
ILMN_1238115 Mus musculus RefSeq NM_178786.2 ILMN_210447 9530098N22RIK NM_178786.2 NM_178786.2 320640 31341839 NM_178786.2 9530098N22Rik NP_848901.1 5290647 S 1815 GTGGTTGTTAGGCTTGTTCTTCTTGTGAGAGTCTTAACAATGGGTGTGCG 4 + 111663826-111663875 Mus musculus RIKEN cDNA 9530098N22 gene (9530098N22Rik), mRNA. scl00320640.1_1-S-1 NM_178786.2
ILMN_2732092 Mus musculus RefSeq scl51356.6_394 ILMN_231388 GRPEL2 NM_021296.2 NM_021296.2 17714 87196330 NM_021296.2 Grpel2 NP_067271.1 6900154 S 3178 CTTGGGTTTTTAGAGCATTGGGGATTGGATGCAAGGTCTCATGAATGCCA 18 - 61838611-61838660 Mus musculus GrpE-like 2, mitochondrial (Grpel2), nuclear gene encoding mitochondrial protein, mRNA. mitochondrion [goid 5739] [evidence IEA]; mitochondrial inner membrane [goid 5743] [evidence IDA] protein folding [goid 6457] [evidence IEA] adenyl-nucleotide exchange factor activity [goid 774] [evidence IEA]; protein homodimerization activity [goid 42803] [evidence IEA]; chaperone binding [goid 51087] [evidence IEA]; unfolded protein binding [goid 51082] [evidence IDA]; protein binding [goid 5515] [evidence IEA] mt-GrpE#2; mt-Grpel2 scl0017714.2_196-S-2 NM_021296.2
ILMN_1231752 Mus musculus RefSeq NM_177450.2 ILMN_217309 CNDP1 NM_177450.2 NM_177450.2 338403 31343343 NM_177450.2 Cndp1 NP_803233.1 5130142 S 2489 GCTCAATGAGTTTATCTGAATTGCTTAAGGCTTTTAACAGCGCCAGCATC 18 - 84744981-84745030 Mus musculus carnosine dipeptidase 1 (metallopeptidase M20 family) (Cndp1), mRNA. cytosol [goid 5829] [evidence ISS] hydrolase activity [goid 16787] [evidence IEA]; dipeptidase activity [goid 16805] [evidence ISS]; protein dimerization activity [goid 46983] [evidence IEA]; metallopeptidase activity [goid 8237] [evidence IEA]; carboxypeptidase activity [goid 4180] [evidence IEA] AI746433; Cn1 scl51187.13.1_39-S-1 NM_177450.2
ILMN_1229397 Mus musculus RefSeq scl020510.12_56 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 520372 S 2256 CAATGTACTGTATTGAGACACTGGTAGCTGACAGCCAGTGTTCGGTATAG Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 integral to membrane [goid 16021] [evidence IEA]; integral to plasma membrane [goid 5887] [evidence IEA]; membrane [goid 16020] [evidence IEA] transport [goid 6810] [evidence IEA]; dicarboxylic acid transport [goid 6835] [evidence IEA] symporter activity [goid 15293] [evidence IEA]; sodium:dicarboxylate symporter activity [goid 17153] [evidence IEA]; carrier activity [goid 5386] [evidence IEA]; glutamate:sodium symporter activity [goid 15501] [evidence IDA] EAAC1; D130048G10Rik; MEAAC1; EAAC2; EAAT3 scl020510.12_56-S-1 NM_009199.2
ILMN_1225873 Mus musculus RefSeq scl020510.12_56 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 6420059 S 3552 CAGGTGGTTCTCCTTAGTGGCAGTGAATTGGCAGAGCCGTTCACAAGATC Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 integral to membrane [goid 16021] [evidence IEA]; integral to plasma membrane [goid 5887] [evidence IEA]; membrane [goid 16020] [evidence IEA] transport [goid 6810] [evidence IEA]; dicarboxylic acid transport [goid 6835] [evidence IEA] symporter activity [goid 15293] [evidence IEA]; sodium:dicarboxylate symporter activity [goid 17153] [evidence IEA]; carrier activity [goid 5386] [evidence IEA]; glutamate:sodium symporter activity [goid 15501] [evidence IDA] EAAC1; D130048G10Rik; MEAAC1; EAAC2; EAAT3 scl0020510.2_224-S-1 NM_009199.2
ILMN_2682763 Mus musculus RefSeq scl30669.5.1_22 ILMN_217398 4930451I11RIK NM_183131.2 NM_183131.2 78118 114158653 NM_183131.2 4930451I11Rik NP_898954.2 1940433 S 406 CCTGGACCCAGCTGTGAGCCACACACATCTACCCTGCCTTCTGTTGAGAA Mus musculus RIKEN cDNA 4930451I11 gene (4930451I11Rik), mRNA. scl30669.5.1_22-S-3 NM_183131.2
ILMN_1251148 Mus musculus RefSeq scl0067230.1_121 ILMN_215300 ZFP329 NM_026046.2 NM_026046.2 67230 71037392 NM_026046.2 Zfp329 NP_080322.2 1410411 S 5339 GGCAATTACATGTGTGATATGTAAGGGGTATGATGTCATGCAACAAGAGG 7 - 11706499-11706548 Mus musculus zinc finger protein 329 (Zfp329), mRNA. nucleus [goid 5634] [evidence IEA]; intracellular [goid 5622] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; nucleic acid binding [goid 3676] [evidence IEA] 2810439M05Rik; 4632409L22Rik; ZNF329 scl0067230.1_121-S-1 NM_026046.2
ILMN_2691286 Mus musculus RefSeq scl0067230.1_121 ILMN_215300 ZFP329 NM_026046.2 NM_026046.2 67230 71037392 NM_026046.2 Zfp329 NP_080322.2 730433 S 1703 CTTGAGTGAACAAAGGATTTGTTTTCAGATGTGACTTCCCTTGCTCGCAG 7 - 11710135-11710184 Mus musculus zinc finger protein 329 (Zfp329), mRNA. nucleus [goid 5634] [evidence IEA]; intracellular [goid 5622] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; nucleic acid binding [goid 3676] [evidence IEA] 2810439M05Rik; 4632409L22Rik; ZNF329 scl067230.1_1-S-9 NM_026046.2
ILMN_2681321 Mus musculus RefSeq scl066797.3_51 ILMN_247293 CNTNAP2 NM_025771.2 NM_025771.2 66797 27754111 NM_025771.2 Cntnap2 NP_080047.1 4280546 S 1050 GCATCTAGTCGACTTTTAATGGGCTGTTGTAGCAACTAGTTTGTGTCCAA 6 + 47228626-47228675 Mus musculus contactin associated protein-like 2 (Cntnap2), transcript variant 2, mRNA. membrane [goid 16020] [evidence IEA] cell adhesion [goid 7155] [evidence IEA] protein binding [goid 5515] [evidence IEA] 5430425M22Rik; mKIAA0868; Caspr2 scl066797.3_51-S-3 NM_025771.2
ILMN_2687446 Mus musculus RefSeq scl012476.8_4 ILMN_253872 CD151 NM_009842.1 NM_009842.1 12476 6753333 NM_009842.1 Cd151 NP_033972.1 3780309 S 1498 GGCACCCTTAATGCCTGCTACCAGGAACTCTCAGATCTGTTGCCCCAAAC 7 + 141322468-141322517 Mus musculus CD151 antigen (Cd151), mRNA. plasma membrane [goid 5886] [evidence IEA]; membrane [goid 16020] [evidence IEA] SFA-1; PETA-3; Tspan24 scl0012476.2_68-S-4 NM_009842.1
ILMN_2598213 Mus musculus RefSeq scl012476.8_4 ILMN_253872 CD151 NM_009842.1 NM_009842.1 12476 6753333 NM_009842.1 Cd151 NP_033972.1 1450592 S 237 GTAGTTGGAGTGGCAAGATCCCACCTGCTAGGTGAAGGGCAGAGAGTGAC 7 + 141319783-141319832 Mus musculus CD151 antigen (Cd151), mRNA. plasma membrane [goid 5886] [evidence IEA]; membrane [goid 16020] [evidence IEA] SFA-1; PETA-3; Tspan24 scl31882.2.42_7-S-3 NM_009842.1
ILMN_2728484 Mus musculus MEEBO scl0077114.1_105 ILMN_220912 6030426L16RIK scl0077114.1_105 NM_183121.1 34147124 NM_183121.1 6030426L16Rik 2480711 S 590 GAAAAAATGAAAGGTTTAATCTTCCAATGCCAGTTGCCATGGGCAAGCCA scl0077114.1_105-S-2 NM_183121.1
ILMN_2748584 Mus musculus RefSeq scl41352.8_186 ILMN_222369 DULLARD NM_026017.2 NM_026017.2 67181 118129887 NM_026017.2 Dullard NP_080293.1 130180 S 1265 GGAAATGCCAGACTGGGACAGGCGAAGGCCTAGAGGAGCCGAAACAGTCT Mus musculus Dullard homolog (Xenopus laevis) (Dullard), mRNA. molecular_function [goid 3674] [evidence ND ]; phosphoric monoester hydrolase activity [goid 16791] [evidence IEA] 2610507E10Rik scl41352.8_186-S-6 NM_026017.2

Total number of rows: 24613

Table truncated, full table size 13747 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6103_Illumina_MouseRef-8_V1_1_R1_11234312_A.bgx.gz 3.3 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap