GEO Profile Links for Gene (Select 76392) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 923

<< First< Prev

Page of 47

Next >Last >>

Select item 86753471.

Unc45b - Bile ductular differentiation of embryonic hepatoblasts: time course

Annotation:: Unc45b, Unc-45 homolog B (C. elegans)

Organism:: Mus musculus

Reporter:: GPL1205, 1449 (ID_REF), GDS970, AA466569

DataSet type:: Expression profiling by array, log ratio, 24 samples

ID:: 8675347

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 177027012.

Slfn5os - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 17301 (ID_REF), GDS1675, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17702701

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1031770453.

Unc45b - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Unc45b, Unc-45 homolog B (C. elegans)

Organism:: Mus musculus

Reporter:: GPL11180, 1436939_PM_at (ID_REF), GDS4791, AV220213

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103177045

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 284820704.

Unc45b - Intra-abdominal adhesions effect on the small intestine: time course

Annotation:: Unc45b, Unc-45 homolog B (C. elegans)

Organism:: Mus musculus

Reporter:: GPL3695, 5170 (ID_REF), GDS2224, AI596307, Unc45b (ORF)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 28482070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63399015.

Slfn5os - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 17301 (ID_REF), GDS775, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6339901

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1304444166.

Slfn5os - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P453616 (ID_REF), GDS5666, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130444416

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1092310397.

Slfn5os - Diabetic db/db heart response to rosiglitazone

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 21139 (ID_REF), GDS4990, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109231039

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 353377218.

Unc45b - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Unc45b, Unc-45 homolog B (C. elegans)

Organism:: Mus musculus

Reporter:: GPL922, 15521 (ID_REF), GDS2571, L0547G11 (CLONE ID), A_65_P04377 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35337721

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249627019.

Slfn5os - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 17301 (ID_REF), GDS2078, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24962701

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4418300110.

Slfn5os - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 17301 (ID_REF), GDS2924, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44183001

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 188921511.

Slfn5os - Ligand screen in B cells: interferon beta

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL260, 5233 (ID_REF), GDS304, AK005634

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1889215

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 748714712.

Slfn5os - MPSS transcriptome analysis project

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCCAGCCACTGGGTTG (ID_REF), GDS868, AK005634

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487147

GEO DataSets Gene Chromosome neighbors

Select item 5298368213.

Slfn5os - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL2872, 37282 (ID_REF), GDS3259, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52983682

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2493940114.

Slfn5os - Estren effect on the uterus: time course

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 17301 (ID_REF), GDS2077, AK005634, A_51_P453616 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24939401

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11249930715.

Slfn5os - Wnt4 mutation effect on female embryonic gonads

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL3108, 9207 (ID_REF), GDS2574, AK005634

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112499307

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7295384516.

Unc45b - Inflammasome-compromised epidydimal white adipose response to a high fat diet

Annotation:: Unc45b, Unc-45 homolog B (C. elegans)

Organism:: Mus musculus

Reporter:: GPL11180, 1436939_PM_at (ID_REF), GDS3925, AV220213

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 72953845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4415953717.

Slfn5os - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL4053, 4937 (ID_REF), GDS2923, AK005634

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 44159537

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11230760718.

Slfn5os - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL1261, 1430901_at (ID_REF), GDS5091, 76392 (Gene ID), AV281513

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112307607

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 197321519.

Slfn5os - Ligand screen in B cells: lysophosphatidic acid

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL260, 5233 (ID_REF), GDS309, AK005634

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1973215

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 207401520.

Slfn5os - Ligand screen in B cells: platelet activating factor

Annotation:: Slfn5os, schlafen 5, opposite strand

Organism:: Mus musculus

Reporter:: GPL260, 5233 (ID_REF), GDS315, AK005634

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2074015

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 47

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 76392) (923)
GEO Profiles
AL024230 expressed sequence AL024230 [Mus musculus]
AL024230 expressed sequence AL024230 [Mus musculus]
Gene ID:404586

Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 923

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity