GEO Profiles Links for Nucleotide (Select 240120131) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 261

<< First< Prev

Page of 14

Next >Last >>

Select item 553489941.

Hsd3b3 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL5759, NM_001012306_at (ID_REF), GDS3385, NM_001012306

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55348994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644255362.

Hsd3b3 - Hypertension model: liver

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL9734, 100110182_TGI_at (ID_REF), GDS3674, NM_001012306

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64425536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441792713.

Hsd3b3 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL891, 13571 (ID_REF), GDS2924, NM_001012306, A_51_P397056 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44179271

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1068088044.

Hsd3b3 - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS4899, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106808804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249589715.

Hsd3b3 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL891, 13571 (ID_REF), GDS2078, NM_001012306, A_51_P397056 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24958971

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1013333046.

Hsd3b3 - Clock mutant cecum response to Salmonella enterica serovar Typhimurium infection at different circadian times

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS4622, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 101333304

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 920999767.

Hsd3b3 - Conventionalization of germ-free C57BL/6 males: time course

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10500555 (ID_REF), GDS4319, NM_001161742, NM_001161743, NM_001161744, NM_001161745, NM_001012306, BC089581, chr3:98545444-98567753 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 144 samples

ID:: 92099976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715514898.

Hsd3b3 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P459818 (ID_REF), GDS3890, NM_001012306, A_52_P459818 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71551489

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1137439769.

Hsd3b3 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10500555 (ID_REF), GDS4918, NM_001161742, NM_001161743, NM_001161744, NM_001161745, NM_001012306, BC089581, chr3:98545444-98567753 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113743976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11321217610.

Hsd3b3 - Fasting effect on vanin-1 depleted liver

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10500555 (ID_REF), GDS4872, NM_001161742, NM_001161743, NM_001161744, NM_001161745, NM_001012306, BC089581, chr3:98545444-98567753 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 113212176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10419700411.

Hsd3b3 - SIRT3 deficient liver response to a high fat diet

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS4817, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 104197004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493567112.

Hsd3b3 - Estren effect on the uterus: time course

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL891, 13571 (ID_REF), GDS2077, NM_001012306, A_51_P397056 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24935671

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11335047613.

Hsd3b3 - c-Jun N-terminal kinase-1 deletion effect on bile duct ligation model of liver fibrosis: time course

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10500555 (ID_REF), GDS4878, NM_001161742, NM_001161743, NM_001161744, NM_001161745, NM_001012306, BC089581, chr3:98545444-98567753 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 113350476

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10293030414.

Hsd3b3 - Liver response to a high fat diet: time course

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS4783, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102930304

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11388487615.

Hsd3b3 - Caspase-1 deficiency effect on fasted liver

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10500555 (ID_REF), GDS4922, NM_001161742, NM_001161743, NM_001161744, NM_001161745, NM_001012306, BC089581, chr3:98545444-98567753 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 113884876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9697320416.

Hsd3b3 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS4490, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96973204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6446513617.

Hsd3b3 - Hypertension model: kidney

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL9734, 100110182_TGI_at (ID_REF), GDS3675, NM_001012306

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64465136

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12400760418.

Hsd3b3 - Folate deficiency effect on methylenetetrahydrofolate reductase MTHFR+/- intestinal neoplasia model: duodenum

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10500555 (ID_REF), GDS5377, NM_001012306, NM_001161742, NM_001161743, NM_001161744, NM_001161745, BC089581, chr3:98741521-98763830 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124007604

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299747119.

Hsd3b3 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL891, 13571 (ID_REF), GDS1359, NM_001012306, A_51_P397056 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12997471

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752960120.

Hsd3b3 - MPSS transcriptome analysis project

Annotation:: Hsd3b3, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCGGGACACTAGTGGAGC (ID_REF), GDS868, NM_001012306

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529601

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 14

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 240120131) (261)
GEO Profiles
BioProject Links for Protein (Select 1039688297) (1)
BioProject
Amycolatopsis orientalis strain:B-37
Amycolatopsis orientalis strain:B-37
Amycolatopsis orientalis strain:B-37 Genome sequencing

BioProject
Mus musculus strain C57BL/6J chromosome 10, GRCm39
Mus musculus strain C57BL/6J chromosome 10, GRCm39
gi|1877089959|gnl|ASM:GCF_000000055 ef|NC_000076.7||gpp|GPC_000007822.1||gnl|NCBI_GENOMES|78

Nucleotide
BioProjects for Gene (Select 109751507) (2)
BioProject

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 261

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity