GEO Profile Links for Gene (Select 271813) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 320

<< First< Prev

Page of 16

Next >Last >>

Select item 1304574521.

Agbl2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P384036 (ID_REF), GDS5666, AK029744, A_52_P384036 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130457452

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63353832.

Agbl2 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS775, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6335383

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249581833.

Agbl2 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS2078, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24958183

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 279671834.

Agbl2 - Estradiol effect on the uterus: time course

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS2208, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27967183

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441784835.

Agbl2 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS2924, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44178483

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130199836.

Agbl2 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS1360, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13019983

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249348837.

Agbl2 - Estren effect on the uterus: time course

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS2077, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24934883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129966838.

Agbl2 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS1359, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12996683

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824620129.

Agbl2 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2626930 (ID_REF), GDS3720, NM_178755

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82462012

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7284570510.

Agbl2 - Spatial and temporal development of mammalian salivary glands

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P330359 (ID_REF), GDS3922, NM_178755, A_52_P330359 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72845705

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12334532111.

Agbl2 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2626930 (ID_REF), GDS5360, NM_178755, AGBL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123345321

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8961975312.

Agbl2 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6246, 10473708 (ID_REF), GDS4423, NM_178755, XM_006499631, XM_006499632, XM_006499641, DQ867026, DQ867027, DQ867028, DQ867029, DQ867030, chr2:90782727-90834437 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89619753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7284735213.

Agbl2 - Spatial and temporal development of mammalian salivary glands

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P384036 (ID_REF), GDS3922, AK029744, A_52_P384036 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72847352

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10923469414.

Agbl2 - Diabetic db/db heart response to rosiglitazone

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL4134, 24794 (ID_REF), GDS4990, NM_178755, A_52_P384036 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109234694

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13164900515.

Agbl2 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P330359 (ID_REF), GDS5818, NM_178755, A_52_P330359 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131649005

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750238116.

Agbl2 - MPSS transcriptome analysis project

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGACCAAACCAAGTA (ID_REF), GDS868, AK040259

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7502381

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12974475317.

Agbl2 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6246, 10473708 (ID_REF), GDS5645, NM_178755, XM_006499631, XM_006499632, XM_006499641, DQ867026, DQ867027, DQ867028, DQ867029, DQ867030, chr2:90782727-90834437 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129744753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9219725318.

Agbl2 - 16p11.2 copy number variation models: various brain regions

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6246, 10473708 (ID_REF), GDS4430, NM_178755, XM_006499631, XM_006499632, XM_006499641, DQ867026, DQ867027, DQ867028, DQ867029, DQ867030, chr2:90782727-90834437 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92197253

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11730145319.

Agbl2 - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL6246, 10473708 (ID_REF), GDS5201, NM_178755, XM_006499631, XM_006499632, XM_006499641, DQ867026, DQ867027, DQ867028, DQ867029, DQ867030, chr2:90782727-90834437 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117301453

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596208320.

Agbl2 - High fat diet effect on aorta: time course

Annotation:: Agbl2, ATP/GTP binding protein-like 2

Organism:: Mus musculus

Reporter:: GPL891, 12783 (ID_REF), GDS735, NM_178755, A_51_P184162 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5962083

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 271813) (320)
GEO Profiles
PREDICTED: major allergen Pru ar 1-like [Solanum tuberosum]
PREDICTED: major allergen Pru ar 1-like [Solanum tuberosum]
gi|971540595|ref|XP_015161736.1|

Protein
PREDICTED: pathogenesis-related protein STH-2-like [Solanum tuberosum]
PREDICTED: pathogenesis-related protein STH-2-like [Solanum tuberosum]
gi|565347758|ref|XP_006340889.1|

Protein
PREDICTED: Mus musculus ATP/GTP binding protein-like 2 (Agbl2), transcript varia...
PREDICTED: Mus musculus ATP/GTP binding protein-like 2 (Agbl2), transcript variant X2, mRNA
gi|1720399384|ref|XM_006499630.3|

Nucleotide
PREDICTED: Mus musculus ATP/GTP binding protein-like 2 (Agbl2), transcript varia...
PREDICTED: Mus musculus ATP/GTP binding protein-like 2 (Agbl2), transcript variant X3, mRNA
gi|1907140124|ref|XM_006499631.4|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 320

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity