GEO Profiles Links for Nucleotide (Select 38614353) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 151

<< First< Prev

Page of 8

Next >Last >>

Select item 74818161.

Skiv2l - MPSS transcriptome analysis project

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGCGGGGCTCAGTGTG (ID_REF), GDS868, BC062925

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7481816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76195162.

Skiv2l - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGCGGGGCTCAGTGTG (ID_REF), GDS878, BC062925

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7619516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750995453.

Skiv2l - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS3987, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75099545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143578454.

Skiv2l - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4946, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114357845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029249455.

Skiv2l - Liver response to a high fat diet: time course

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4783, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102924945

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666466456.

Skiv2l - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS3748, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66646645

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44810327.

Skiv2l - Zygotic gene activation

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11932 (ID_REF), GDS579, AK029763, AK087810, BC023478, BC062925, BC055297, H3128B09-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481032

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1318650458.

Skiv2l - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS5824, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131865045

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1000542459.

Skiv2l - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4588, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100054245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11439454510.

Skiv2l - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4948, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114394545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9696784511.

Skiv2l - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4490, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96967845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10469254512.

Skiv2l - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4827, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104692545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7939374513.

Skiv2l - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4116, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79393745

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7211674514.

Skiv2l - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS3904, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72116745

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683044515.

Skiv2l - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4486, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96830445

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7935704516.

Skiv2l - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4115, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79357045

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7555034517.

Skiv2l - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS3999, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75550345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8961724518.

Skiv2l - Lung epithelium response to fungal allergen Alternaria

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4423, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89617245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9966444519.

Skiv2l - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS4578, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99664445

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13205804520.

Skiv2l - Nebulin deficiency effect on the soleus

Annotation:: Skiv2l, superkiller viralicidic activity 2-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10450296 (ID_REF), GDS5881, NM_021337, BC062925, BC065999, chr17:34839226-34850204 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132058045

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 38614353) (151)
GEO Profiles
BioAssays, RNAi Target, Active for Gene (Select 10365) (2)
PubChem BioAssay
Related DataSets for GEO Profiles (Select 114078911) (1)
GEO DataSets
Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic be...
Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic beta-cells
Accession: GDS4933

GEO DataSets
Related DataSets for GEO Profiles (Select 114078909) (1)
GEO DataSets

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 151

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity