GEO Profiles Links for Nucleotide (Select 19264038) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 188

<< First< Prev

Page of 10

Next >Last >>

Select item 1325960871.

Pard6b - Caspase-1 deficiency effect on lipid-loaded intestines

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL11533, 10478907 (ID_REF), GDS6176, NM_021409, BC025147, chr2:167906735-167926694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 132596087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 826825822.

Pard6b - Pluripotent embryonic stem cells and multipotent adult germline stem cells in 129SV and Stra8-EGFP/Rosa26-LacZ strains

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4170, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 82682582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644577313.

Pard6b - Hypertension model: kidney

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL9734, 100118898_TGI_at (ID_REF), GDS3675, BC025147

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64457731

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 881219824.

Pard6b - Sox9+ pancreatic cells: developmental time course

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4335, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88121982

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74625875.

Pard6b - MPSS transcriptome analysis project

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAGCTGCTGACGCTG (ID_REF), GDS868, BC025147

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7462587

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1067697826.

Pard6b - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4898, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106769782

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 941934827.

Pard6b - Endoplasmic reticulum thiol oxidase deficiency effect on embryonic fibroblasts

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4507, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 94193482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 46406908.

Pard6b - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m16426_at (ID_REF), GDS592, BC025147

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4640690

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1107342829.

Pard6b - High Mobility Group AT-hook Protein 2 deficiency effect on the embryonic lung

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS5048, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 110734282

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8472008210.

Pard6b - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4371, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84720082

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8460018211.

Pard6b - DSS-induced colitis model response to L-arginine supplementation

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4368, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 84600182

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9848768212.

Pard6b - Pulmonary vascular microendothelial cell response to mutations in type 2 receptor for the bone morphogenetic protein signaling pathway, BMPR2

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4543, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 98487682

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7538008213.

Pard6b - Developing testis and ovary

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS3995, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75380082

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10680648214.

Pard6b - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4899, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106806482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10296468215.

Pard6b - Post-pneumonectomy lung regeneration: time course

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4784, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 21 samples

ID:: 102964682

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12436768216.

Pard6b - Transforming growth factor β effect on mammary epithelial NMuMG cells overexpressing major satellite transcripts

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS5387, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124367682

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11408258217.

Pard6b - Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic beta-cells

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4933, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 114082582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11490428218.

Pard6b - Very low density lipoprotein receptor knockout effect in house dust mite model of asthma: lung

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS4999, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 114904282

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5182406419.

Pard6b - Interleukin-22 effect on colon cultures

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL2872, 35964 (ID_REF), GDS3226, BC025147, A_52_P455764 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51824064

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11730198220.

Pard6b - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: Pard6b, par-6 family cell polarity regulator beta

Organism:: Mus musculus

Reporter:: GPL6246, 10478907 (ID_REF), GDS5201, NM_021409, AF252291, BC025147, chr2:168081235-168101194 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117301982

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 10

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 19264038) (188)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 188

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity