GEO Profile Links for Gene (Select 232371) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 395

<< First< Prev

Page of 20

Next >Last >>

Select item 76096501.

C1rl - MPSS analysis of BLK CL.4 and liver cells

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTTGAAACCGGGAG (ID_REF), GDS878, NM_181344

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7609650

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1068131052.

C1rl - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6246, 10541670 (ID_REF), GDS4899, NM_181344, AF456428, AK162497, BC070472, chr6:124493134-124510643 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106813105

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553791173.

C1rl - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL891, 3417 (ID_REF), GDS3386, NM_181344, A_51_P251367 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55379117

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1210023444.

C1rl - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1255190 (ID_REF), GDS5293, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 121002344

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1137482015.

C1rl - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL11533, 10541670 (ID_REF), GDS4918, NM_181344, BC070472, chr6:124443152-124460661 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113748201

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226248446.

C1rl - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1255190 (ID_REF), GDS5342, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122624844

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644254447.

C1rl - Hypertension model: liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL9734, 100110228_TGI_at (ID_REF), GDS3674, AF456428

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64425444

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 950786488.

C1rl - Sebacic acid supplemented diet effect on db/db liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1255190 (ID_REF), GDS3807, NM_181344

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 95078648

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1257921449.

C1rl - Monoacylglycerol acyltransferase 1 deficiency effect on high-fat diet fed mice: liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1255190 (ID_REF), GDS5425, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125792144

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13274244510.

C1rl - Diet-induced obesity model: liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2728796 (ID_REF), GDS6248, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, transformed count, 51 samples

ID:: 132742445

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8361490511.

C1rl - Transcription factor MIST1-null and MIST1-induced pancreas

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6246, 10541670 (ID_REF), GDS4341, NM_181344, AF456428, AK162497, BC070472, chr6:124493134-124510643 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 83614905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6620706512.

C1rl - X chromosome dosage model

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1255190 (ID_REF), GDS3728, NM_181344

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66207065

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6403760513.

C1rl - SIRT1 deficiency effect on the liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P251367 (ID_REF), GDS3666, NM_181344, A_51_P251367 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64037605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7152690514.

C1rl - Interstrain differences in the liver effects of trichloroethylene

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P251367 (ID_REF), GDS3890, NM_181344, A_51_P251367 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71526905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12003684415.

C1rl - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1255190 (ID_REF), GDS5271, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120036844

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11525298216.

C1rl - Glucocorticoid effect on the male liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL4134, 1882 (ID_REF), GDS5035, NM_181344, A_51_P251367 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115252982

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6506095017.

C1rl - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL2995, 438215 (ID_REF), GDS3692, NM_181344

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65060950

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747195018.

C1rl - MPSS transcriptome analysis project

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTTGAAACCGGGAG (ID_REF), GDS868, NM_181344

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7471950

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12262484519.

C1rl - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2728796 (ID_REF), GDS5342, NM_181344, C1RL (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122624845

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10293460520.

C1rl - Liver response to a high fat diet: time course

Annotation:: C1rl, complement component 1, r subcomponent-like

Organism:: Mus musculus

Reporter:: GPL6246, 10541670 (ID_REF), GDS4783, NM_181344, AF456428, AK162497, BC070472, chr6:124493134-124510643 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102934605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 20

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 232371) (395)
GEO Profiles
PubChem Compound Links for Gene (Select 335429) (3)
PubChem Compound
Danio rerio strain:Tuebingen
Danio rerio strain:Tuebingen
Zebrafish reference genome sequence

BioProject
BioProjects for Gene (Select 81540) (1)
BioProject
Gene neighbors for Gene (Select 373909) (5)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 395

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity