GEO Profiles Links for Nucleotide (Select 71067101) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 387

<< First< Prev

Page of 20

Next >Last >>

Select item 327312231.

Akr1b10 - Prostate cancer progression model: stromal cell

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL4371, 7823 (ID_REF), GDS2443, NM_172398

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32731223

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1233162682.

Akr1b10 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2733753 (ID_REF), GDS5360, NM_172398, 2310005E10RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123316268

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643258983.

Akr1b10 - Hypertension model: aorta

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL9734, 100111644_TGI_at (ID_REF), GDS3672, NM_172398

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64325898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74668094.

Akr1b10 - MPSS transcriptome analysis project

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCAAGTCTGTGACAC (ID_REF), GDS868, NM_172398

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466809

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278295135.

Akr1b10 - Rhabdomyosarcoma model

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6481, 3850113 (ID_REF), GDS5527, NM_172398, 2310005E10Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127829513

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 978380986.

Akr1b10 - Atherosclerosis susceptibility model: macrophages

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL9734, 100111644_TGI_at (ID_REF), GDS4527, NM_172398

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97838098

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1213954637.

Akr1b10 - Negative elongation factor B subunit deficiency effect on the heart

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2733753 (ID_REF), GDS5302, NM_172398

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121395463

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643654988.

Akr1b10 - Hypertension model: heart

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL9734, 100111644_TGI_at (ID_REF), GDS3673, NM_172398

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64365498

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064394979.

Akr1b10 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6246, 10537157 (ID_REF), GDS4886, NM_172398, BC026843, BC037690, chr6:34384247-34396949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106439497

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4819421510.

Akr1b10 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL4234, 3850113 (ID_REF), GDS3086, NM_172398

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48194215

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13105596311.

Akr1b10 - Radioactive iodine effect on normal thyroid: dose response

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2733753 (ID_REF), GDS5803, NM_172398

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 131055963

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12622956812.

Akr1b10 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2733753 (ID_REF), GDS5436, NM_172398, 2310005E10RIK (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126229568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13221266913.

Akr1b10 - High-fat diet effect on brown adipose tissue development

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2616422 (ID_REF), GDS6000, NM_172398, 2310005E10RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132212669

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10561924514.

Akr1b10 - Acute cold exposure effect on skeletal muscle

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2733753 (ID_REF), GDS4849, NM_172398

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 105619245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12729426315.

Akr1b10 - Left ventricle myocardium from MerCreMer model of transient cardiomyopathy: time course

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2733753 (ID_REF), GDS5469, NM_172398

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 127294263

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12571076316.

Akr1b10 - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2733753 (ID_REF), GDS5422, NM_172398

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125710763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6619030517.

Akr1b10 - X chromosome dosage model

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2733753 (ID_REF), GDS3728, NM_172398

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66190305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13121876818.

Akr1b10 - Snail transcription factor/ERα ligand-binding region chimeric protein effect on embryonic stem cells: time course

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2733753 (ID_REF), GDS5807, NM_172398, 2310005E10RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131218768

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12108906819.

Akr1b10 - Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2733753 (ID_REF), GDS5295, NM_172398, 2310005E10RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121089068

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11374770220.

Akr1b10 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Akr1b10, aldo-keto reductase family 1, member B10 (aldose reductase)

Organism:: Mus musculus

Reporter:: GPL11533, 10537157 (ID_REF), GDS4918, NM_172398, BC037690, chr6:34334247-34346949 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113747702

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 20

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 71067101) (387)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 387

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity