GEO Profiles Links for Nucleotide (Select 548923771) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 302021891.

Asic2 - High and low weight gainers: hypothalamus

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL2995, 854120 (ID_REF), GDS2320, NM_007384

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30202189

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201654252.

Asic2 - Age effect on hematopoietic stem cells

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS1803, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20165425

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388109253.

Asic2 - Pubertal mammary gland development

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL339, 1417994_a_at (ID_REF), GDS2721, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38810925

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316321784.

Asic2 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P334876 (ID_REF), GDS5818, NM_007384, A_51_P334876 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131632178

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1066771255.

Asic2 - SIRT1 deficiency effect on the brain

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL8321, 1417994_a_at (ID_REF), GDS4895, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 106677125

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 370029256.

Asic2 - Asthma model: lungs

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS2647, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37002925

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270782647.

Asic2 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL4134, 45064 (ID_REF), GDS5461, NM_007384, A_51_P334876 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127078264

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303900648.

Asic2 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL4134, 45064 (ID_REF), GDS5664, NM_007384, A_51_P334876 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130390064

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092549649.

Asic2 - Diabetic db/db heart response to rosiglitazone

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL4134, 45064 (ID_REF), GDS4990, NM_007384, A_51_P334876 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109254964

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11220172510.

Asic2 - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS5089, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112201725

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748966311.

Asic2 - MPSS transcriptome analysis project

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTGTGTTGTTCGTGA (ID_REF), GDS868, NM_007384

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489663

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6506448912.

Asic2 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL2995, 854120 (ID_REF), GDS3692, NM_007384

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65064489

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5054652513.

Asic2 - Transcription factor Ctip2 deficiency effect on brain striata

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS3178, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 50546525

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11294502514.

Asic2 - Progesterone effect on uteri of ovariectomized, steroid receptor coregulator-2 deficient mutants

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS4866, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 112945025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7564893515.

Asic2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL6481, 2060139 (ID_REF), GDS4002, NM_007384, Accn1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75648935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11258912516.

Asic2 - Atypical neuroleptic quetiapine effect on brain: dose response

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS4623, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 112589125

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2142716717.

Asic2 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1792, M200002649 (ID_REF), GDS1874, NM_007384

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21427167

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9842922518.

Asic2 - Chronic suppression of phosphodiesterase 10A effect on striatum and hippocampus

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS4542, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 42 samples

ID:: 98429225

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7259712519.

Asic2 - Various central nervous system regions of adult inbred strain

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS3917, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, transformed count, 102 samples

ID:: 72597125

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4396892520.

Asic2 - Various brain regions of several inbred strains

Annotation:: Asic2, acid-sensing (proton-gated) ion channel 2

Organism:: Mus musculus

Reporter:: GPL1261, 1417994_a_at (ID_REF), GDS2917, 11418 (Gene ID), NM_007384

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43968925

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 548923771) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity