GEO Profiles Links for Nucleotide (Select 285403408) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 295

<< First< Prev

Page of 15

Next >Last >>

Select item 1212950141.

Abhd17a - Restless Legs Syndrome model: adult whole brain

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS5299, NM_145421

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121295014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226128142.

Abhd17a - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5342, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122612814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1209903143.

Abhd17a - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5293, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 120990314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159118144.

Abhd17a - Auditory fear conditioning effect on amygdala: time course

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5157, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115911814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 719139145.

Abhd17a - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS3900, NM_145421

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71913914

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 727800146.

Abhd17a - Intestinal microbiota depletion effect on colon epithelial cells

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS3921, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 72780014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746167147.

Abhd17a - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS3974, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74616714

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1317689148.

Abhd17a - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5821, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131768914

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318156149.

Abhd17a - Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5822, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131815614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12620301410.

Abhd17a - Dietary palatinose effect on liver

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS5435, NM_145421

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126203014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12132151411.

Abhd17a - Restless Legs Syndrome model: embryonic forebrain

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS5300, NM_145421

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 121321514

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13122311412.

Abhd17a - Snail transcription factor/ERα ligand-binding region chimeric protein effect on embryonic stem cells: time course

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5807, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131223114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753333613.

Abhd17a - MPSS transcriptome analysis project

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL1010, GATCGACTTCTCTCACGGGC (ID_REF), GDS868, NM_145421

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533336

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6227081414.

Abhd17a - Claudin16 deficiency effect on kidneys

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS3612, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62270814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12591311415.

Abhd17a - CD40 activation effect on DBC1-deficient splenic B cells

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS5428, NM_145421

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125913114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9508171416.

Abhd17a - Sebacic acid supplemented diet effect on db/db liver

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS3807, NM_145421

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 95081714

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6354551417.

Abhd17a - ob/ob liver response to low doses of leptin

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS3653, NM_145421

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 63545514

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12002481418.

Abhd17a - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5271, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120024814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12982581419.

Abhd17a - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3163027 (ID_REF), GDS5648, NM_145421, FAM108A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129825814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11141831420.

Abhd17a - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Abhd17a, abhydrolase domain containing 17A

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3163027 (ID_REF), GDS5066, NM_145421

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111418314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 285403408) (295)
GEO Profiles
Mus musculus
Mus musculus
RefSeq annotation of the mouse reference genome assembly.

BioProject
BioProject Links for Protein (Select 84875498) (1)
BioProject

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 295

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity