GEO Profiles Links for Nucleotide (Select 23958443) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 295

<< First< Prev

Page of 15

Next >Last >>

Select item 1065927431.

LOC102633627 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4893, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106592743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123499432.

LOC102633627 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS5092, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112349943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064301433.

LOC102633627 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4886, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106430143

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76291994.

Tpm4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCATTGTTGCCCATGTGC (ID_REF), GDS878, BC023701

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7629199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143713365.

Tpm4 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10572747 (ID_REF), GDS4946, NM_001001491, BC023827, BC070421, BC023701, chr8:72135286-72153140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114371336

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318648436.

LOC102633627 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS5824, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131864843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143576437.

LOC102633627 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4946, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114357643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1140426438.

LOC102633627 - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4932, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114042643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 996642439.

LOC102633627 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4578, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99664243

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13070373610.

Tpm4 - Glucagon effect on hepatocytes deficient in lysine acetyltransferase 2B or WD repeat-containing protein 5

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10572747 (ID_REF), GDS5673, NM_001001491, BC023827, BC070421, BC023701, chr8:72135286-72153140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 130703736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12568004311.

LOC102633627 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS5421, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125680043

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11405633612.

Tpm4 - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10572747 (ID_REF), GDS4932, NM_001001491, BC023827, BC070421, BC023701, chr8:72135286-72153140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114056336

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8376454313.

LOC102633627 - Pancreatic CD45+ immune cells from NOD model of type 1 diabetes

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4347, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 83764543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7939354314.

LOC102633627 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4116, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79393543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11439434315.

LOC102633627 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4948, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114394343

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10005404316.

LOC102633627 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS4588, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100054043

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4682716217.

Tpm4 - Dicer inactivation effect on the embryonic heart

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL5025, 29662 (ID_REF), GDS3033, BC023701

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46827162

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7509934318.

LOC102633627 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS3987, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75099343

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11828574319.

LOC102633627 - Adam10 deficiency effect on the epidermis

Annotation:: LOC102633627, tropomyosin alpha-4 chain pseudogene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6246, 10448202 (ID_REF), GDS5229, NM_001001491, XR_385459, BC023701, BC023827, BC070421, AK206089, chr17:21967495-21968242 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118285743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10660643620.

Tpm4 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Tpm4, tropomyosin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10572747 (ID_REF), GDS4893, NM_001001491, BC023827, BC070421, BC023701, chr8:72135286-72153140 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106606436

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 23958443) (295)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 295

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity