GEO Profiles Links for Nucleotide (Select 147905739) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 238

<< First< Prev

Page of 12

Next >Last >>

Select item 896289351.

Muc5b - Lung epithelium response to fungal allergen Alternaria

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS4423, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89628935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596443662.

Muc5b - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2602097 (ID_REF), GDS3522, NM_028801

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59644366

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130171043.

Muc5b - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL891, 9904 (ID_REF), GDS1360, NM_028801, A_51_P122071 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13017104

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1129284854.

Muc5b - P81S von Hippel-Lindau mutation effect on embryonic stem cell teratomas

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL11533, 10559095 (ID_REF), GDS4865, NM_028801, chr7:149024975-149058990 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 112928485

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1297539355.

Muc5b - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS5645, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129753935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1118462356.

Muc5b - Fra-1 deficient lung response to fibrotic agent bleomycin

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS5078, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 111846235

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666895247.

Muc5b - Intratracheal lipopolysaccharide (IT LPS)-induced lung injury effect on Rag-1 null, lymphocyte-deficient mutants

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL4865, scl31873.50.1_216-S (ID_REF), GDS3749, NM_028801

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 66689524

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029733358.

Muc5b - Post-pneumonectomy lung regeneration: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS4784, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 21 samples

ID:: 102973335

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 757335339.

Muc5b - Cyclophosphamide effect on splenocytes: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL13209, 028A09 (ID_REF), GDS4005, NM_028801

DataSet type:: Expression profiling by array, log2 ratio, 38 samples

ID:: 75733533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6506710310.

Muc5b - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL2995, 558830 (ID_REF), GDS3692, NM_028801

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65067103

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11602996011.

Muc5b - Lung response to highly virulent or low virulent influenza A H3N2 virus infection: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2602097 (ID_REF), GDS5159, NM_028801

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 116029960

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11491293512.

Muc5b - Very low density lipoprotein receptor knockout effect in house dust mite model of asthma: lung

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS4999, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 114912935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11107263513.

Muc5b - Mepenzolate bromide effect on lung: time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS5057, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 111072635

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9273953514.

Muc5b - Zinc finger transcription factor Fezf1 deficiency effect on main olfactory epithelial cells

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS4446, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92739535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12784057215.

Muc5b - Rhabdomyosarcoma model

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6481, 6110121 (ID_REF), GDS5527, NM_028801, Muc5b (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127840572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10848353516.

Muc5b - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS4967, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108483535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750035017.

Muc5b - MPSS transcriptome analysis project

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGGGTTGAAGAGGGG (ID_REF), GDS868, NM_028801

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7500350

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6362162418.

Muc5b - Post-ischemic heart failure model

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL5371, 7224 (ID_REF), GDS3655, NM_028801, Muc5b (ORF)

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 63621624

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11731063519.

Muc5b - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6246, 10559095 (ID_REF), GDS5201, NM_028801, chr7:141839070-141873085 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117310635

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8246976620.

Muc5b - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Muc5b, mucin 5, subtype B, tracheobronchial

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2602097 (ID_REF), GDS3720, NM_028801

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82469766

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 12

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 147905739) (238)
GEO Profiles
Mus musculus strain C57BL/6J chromosome 5, GRCm39
Mus musculus strain C57BL/6J chromosome 5, GRCm39
gi|1877089964|gnl|ASM:GCF_000000055 f|NC_000071.7||gpp|GPC_000007817.1||gnl|NCBI_GENOMES|73

Nucleotide
Component(Core) Links for Nucleotide (Select 147905739) (3)
Nucleotide
Mus musculus strain C57BL/6J chromosome 7, GRCm39
Mus musculus strain C57BL/6J chromosome 7, GRCm39
gi|1877089962|gnl|ASM:GCF_000000055 f|NC_000073.7||gpp|GPC_000007819.1||gnl|NCBI_GENOMES|75

Nucleotide
Taxonomy Links for Nucleotide (Select 261279677) (1)
Taxonomy

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 238

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity