GEO Profile Links for Gene (Select 77610) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 70

<< First< Prev

Page of 4

Next >Last >>

Select item 156059491.

Trpm3 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL2727, 19049 (ID_REF), GDS1527, BG069274, BG082293, H3074F03 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15605949

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215836232.

C330002G04Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: C330002G04Rik, RIKEN cDNA C330002G04 gene

Organism:: Mus musculus

Reporter:: GPL1942, 33623 (ID_REF), GDS1882, AK021170

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21583623

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 499497963.

C330002G04Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: C330002G04Rik, RIKEN cDNA C330002G04 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1224810_1 (ID_REF), GDS3148, AK021170

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49949796

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 223466334.

Trpm3 - Growth hormone effect on bone: time course

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL922, 20833 (ID_REF), GDS1929, H3074F03 (CLONE ID), A_65_P18809 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 22346633

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83863055.

Trpm3 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL1230, 14205 (ID_REF), GDS947, BG082293

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8386305

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 83778416.

Trpm3 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL1230, 5741 (ID_REF), GDS947, BG082293

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8377841

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 215836247.

C330002G04Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: C330002G04Rik, RIKEN cDNA C330002G04 gene

Organism:: Mus musculus

Reporter:: GPL1942, 33624 (ID_REF), GDS1882, AK021170

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21583624

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 203965698.

Trpm3 - Surgical model of acute lymphedema induction

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL3506, 19049 (ID_REF), GDS1810, BG069274, H3074F03 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 9 samples

ID:: 20396569

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1031970189.

Trpm3 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL11180, 1456923_PM_at (ID_REF), GDS4791, BB377721

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103197018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3534303310.

Trpm3 - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL922, 20833 (ID_REF), GDS2571, H3074F03 (CLONE ID), A_65_P18809 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35343033

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12746731811.

Trpm3 - Methylphenidate effect on substantia nigra: dose response

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL11180, 1456923_PM_at (ID_REF), GDS5497, BB377721

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 127467318

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4682896212.

C330002G04Rik - Dicer inactivation effect on the embryonic heart

Annotation:: C330002G04Rik, RIKEN cDNA C330002G04 gene

Organism:: Mus musculus

Reporter:: GPL5025, 31462 (ID_REF), GDS3033, BC044868

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46828962

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10442751813.

Trpm3 - Platelet-derived growth factor receptor alpha-driven pediatric glioblastoma model with p53 null background

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL11180, 1456923_PM_at (ID_REF), GDS4821, BB377721

DataSet type:: Expression profiling by array, transformed count, 45 samples

ID:: 104427518

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4143266214.

C330002G04Rik - Nephronophthisis model

Annotation:: C330002G04Rik, RIKEN cDNA C330002G04 gene

Organism:: Mus musculus

Reporter:: GPL2897, 355014 (ID_REF), GDS2817, BC044868

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41432662

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 789397215.

Trpm3 - Aquaporin-1 knockout kidney inner medulla profile (I)

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL1104, H3074F03 (ID_REF), GDS899, BG069274

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 7893972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4516119716.

Trpm3 - Male and female thymi response to aging and caloric restriction (A)

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL738, 3297 (ID_REF), GDS2961, BG082293

DataSet type:: Expression profiling by array, transformed count, 67 samples

ID:: 45161197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10318207217.

Trpm3 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL11180, 1441966_PM_at (ID_REF), GDS4791, BG069274

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103182072

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12745237218.

Trpm3 - Methylphenidate effect on substantia nigra: dose response

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL11180, 1441966_PM_at (ID_REF), GDS5497, BG069274

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 127452372

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3023743319.

Trpm3 - Vascular endothelial cell differentiation in vitro

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL922, 20833 (ID_REF), GDS2322, H3074F03 (CLONE ID), A_65_P18809 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 24 samples

ID:: 30237433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749032020.

Trpm3 - MPSS transcriptome analysis project

Annotation:: Trpm3, Transient receptor potential cation channel, subfamily M, member 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTTCAATTCGTCCAA (ID_REF), GDS868, BU612722

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7490320

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 4

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77610) (70)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 70

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity