GEO Profile Links for Gene (Select 320385) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 20

Select item 279685831.

D330005D02Rik - Estradiol effect on the uterus: time course

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS2208, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27968583

GEO DataSets Gene Profile neighbors

Select item 441798832.

D330005D02Rik - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS2924, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44179883

GEO DataSets Gene Profile neighbors

Select item 130213833.

D330005D02Rik - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS1360, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13021383

GEO DataSets Gene Profile neighbors

Select item 971562904.

D330005D02Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS4495, AK084481

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97156290

GEO DataSets Gene Profile neighbors

Select item 625712195.

D330005D02Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl48602.1_388-S (ID_REF), GDS3621, D330005D02Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62571219

GEO DataSets Gene Profile neighbors

Select item 63367836.

D330005D02Rik - Typical and atypical antipsychotic drugs effect on brain

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS775, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6336783

GEO DataSets Gene Profile neighbors

Select item 249362837.

D330005D02Rik - Estren effect on the uterus: time course

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS2077, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24936283

GEO DataSets Gene Profile neighbors

Select item 59634838.

D330005D02Rik - High fat diet effect on aorta: time course

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS735, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5963483

GEO DataSets Gene Profile neighbors

Select item 643966909.

D330005D02Rik - Hypertension model: heart

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS3673, AK084481

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64396690

GEO DataSets Gene Profile neighbors

Select item 5538988310.

D330005D02Rik - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS3386, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55389883

GEO DataSets Gene

Select item 1769958311.

D330005D02Rik - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS1675, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17699583

GEO DataSets Gene Profile neighbors

Select item 1299808312.

D330005D02Rik - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS1359, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12998083

GEO DataSets Gene Profile neighbors

Select item 6197081913.

D330005D02Rik - Eset depletion effect on embryonic stem cell

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl48602.1_388-S (ID_REF), GDS3599, D330005D02Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61970819

GEO DataSets Gene Profile neighbors

Select item 2495958314.

D330005D02Rik - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL891, 14183 (ID_REF), GDS2078, AK084481, A_51_P449156 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24959583

GEO DataSets Gene

Select item 747864115.

D330005D02Rik - MPSS transcriptome analysis project

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGATGAGGAGACAG (ID_REF), GDS868, AK046361

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7478641

GEO DataSets Gene

Select item 761634116.

D330005D02Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGATGAGGAGACAG (ID_REF), GDS878, AK046361

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7616341

GEO DataSets Gene

Select item 9786929017.

D330005D02Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS4527, AK084481

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97869290

GEO DataSets Gene

Select item 6447589018.

D330005D02Rik - Hypertension model: kidney

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS3675, AK084481

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64475890

GEO DataSets Gene Profile neighbors

Select item 6443629019.

D330005D02Rik - Hypertension model: liver

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS3674, AK084481

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64436290

GEO DataSets Gene Profile neighbors

Select item 6435709020.

D330005D02Rik - Hypertension model: aorta

Annotation:: D330005D02Rik, RIKEN cDNA D330005D02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100105139_TGI_at (ID_REF), GDS3672, AK084481

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64357090

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320385) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 20

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity