GEO Profile Links for Gene (Select 320118) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 890303371.

Fbxl13 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL1261, 1445131_at (ID_REF), GDS4408, 320118 (Gene ID), BG071043

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89030337

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129885512.

Fbxl13 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL891, 4651 (ID_REF), GDS1359, NM_177076, A_51_P427132 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12988551

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162639983.

Fbxl13 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3155021 (ID_REF), GDS5172, NM_177076, FBXL13 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116263998

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 32344404.

Fbxl13 - Malaria resistance

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL519, 8940 (ID_REF), GDS471, AU017994

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3234440

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553630125.

Fbxl13 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL5759, NM_177076_at (ID_REF), GDS3385, NM_177076

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55363012

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 327248606.

Fbxl13 - Prostate cancer progression model: stromal cell

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL4371, 1460 (ID_REF), GDS2443, NM_177076

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32724860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75078947.

Fbxl13 - MPSS transcriptome analysis project

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGACTCCAAACACCA (ID_REF), GDS868, CO797010

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7507894

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1304431758.

Fbxl13 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P427132 (ID_REF), GDS5666, NM_177076, A_51_P427132 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130443175

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 176900519.

Fbxl13 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL891, 4651 (ID_REF), GDS1675, NM_177076, A_51_P427132 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17690051

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11626399610.

Fbxl13 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3075927 (ID_REF), GDS5172, NM_177076, FBXL13 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116263996

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13268879811.

Fbxl13 - Diet-induced obesity model: white adipose tissue

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3155021 (ID_REF), GDS6247, NM_177076, FBXL13 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132688798

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 463216512.

Fbxl13 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m07901_a_at (ID_REF), GDS592, 4921539K22 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4632165

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10925235913.

Fbxl13 - Diabetic db/db heart response to rosiglitazone

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL4134, 42459 (ID_REF), GDS4990, NM_177076, A_51_P427132 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109252359

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12772289814.

Fbxl13 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3155021 (ID_REF), GDS5520, NM_177076, FBXL13 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127722898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2495005115.

Fbxl13 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL891, 4651 (ID_REF), GDS2078, NM_177076, A_51_P427132 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24950051

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11184281116.

Fbxl13 - Fra-1 deficient lung response to fibrotic agent bleomycin

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6246, 10528310 (ID_REF), GDS5078, NM_001199632, NM_177076, AK030172, BC145291, BC145292, chr5:21483848-21645605 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 111842811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10296991117.

Fbxl13 - Post-pneumonectomy lung regeneration: time course

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6246, 10528310 (ID_REF), GDS4784, NM_001199632, NM_177076, AK030172, BC145291, BC145292, chr5:21483848-21645605 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 21 samples

ID:: 102969911

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9547203718.

Fbxl13 - NZM2410-derived lupus susceptibility locus Sle2c1: peritoneal cavity B cells

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL1261, 1445131_at (ID_REF), GDS4191, 320118 (Gene ID), BG071043

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 95472037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3260653719.

Fbxl13 - Limbal and central corneal epithelial basal cell comparison

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL1261, 1445131_at (ID_REF), GDS2433, 320118 (Gene ID), BG071043

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32606537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10848011120.

Fbxl13 - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Fbxl13, F-box and leucine-rich repeat protein 13

Organism:: Mus musculus

Reporter:: GPL6246, 10528310 (ID_REF), GDS4967, NM_001199632, NM_177076, AK030172, BC145291, BC145292, chr5:21483848-21645605 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108480111

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320118) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity