GEO Profile Links for Gene (Select 269855) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 997

<< First< Prev

Page of 50

Next >Last >>

Select item 301782971.

Ssc5d - High and low weight gainers: hypothalamus

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL2995, 714560 (ID_REF), GDS2320, NM_173008

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30178297

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1261461352.

Ssc5d - Articular cartilage zones: 1-week old normal proximal tibia

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS5433, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 126146135

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 246392093.

Ssc5d - Transcription factor Egr3 expression effect on primary myotubes (MG-430B)

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL340, 1439529_at (ID_REF), GDS2060, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 24639209

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 299738094.

Ssc5d - Akt1 serine-threonine protein kinase activation effect on the heart (MG-430B)

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL340, 1439529_at (ID_REF), GDS2308, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29973809

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824820135.

Ssc5d - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2627774 (ID_REF), GDS3720, NM_173008

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82482013

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1185556356.

Ssc5d - Lamin A exon 9 deletion effect on fibroblasts

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS5235, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118555635

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 265341097.

Ssc5d - RNA helicase p68/p72 knockdown effect on skeletal muscle cells (MG-430B)

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL340, 1439529_at (ID_REF), GDS2152, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26534109

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 516225358.

Ssc5d - Liver response to human and chimpanzee diets

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS3221, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 51622535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1140534389.

Ssc5d - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL6246, 10549733 (ID_REF), GDS4932, NM_173008, BC141044, EU850434, XM_006540022, chr7:4925844-4944821 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114053438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1941420910.

Ssc5d - Extraocular and hindlimb skeletal muscle cell differentiation: time course (MG-430B)

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL340, 1439529_at (ID_REF), GDS1766, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 19414209

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493706111.

Ssc5d - Estren effect on the uterus: time course

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL891, 14961 (ID_REF), GDS2077, NM_173008, A_51_P452659 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24937061

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2225213512.

Ssc5d - ErbB2/Neu and luteinizing hormone overexpression effect on the mammary gland: time course

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS1924, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22252135

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4231943513.

Ssc5d - Myogenic transcription factor MyoD mutant expression effect on embryonic fibroblast: time course

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS2854, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 42319435

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12559773814.

Ssc5d - MEK inhibitor PD-0325901 and rapamycin combined treatment effect on malignant peripheral nerve sheath tumor model

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL6246, 10549733 (ID_REF), GDS5419, NM_173008, BC141044, EU850434, XM_006540022, chr7:4925844-4944821 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 125597738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2202393515.

Ssc5d - Hepatocyte nuclear factor 4 alpha knockout effect on the embryonic liver

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS1916, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22023935

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3422683516.

Ssc5d - Transcriptional coactivator PGC-1beta hypomorphic mutation effect on the skeletal muscle

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1261, 1439529_at (ID_REF), GDS2515, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 34226835

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7562928717.

Ssc5d - High and Low Anxiety: multiple brain regions

Annotation:: Ssc5d, Scavenger receptor cysteine rich domain containing (5 domains)

Organism:: Mus musculus

Reporter:: GPL7467, 18236 (ID_REF), GDS4001, AI845825

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75629287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751685418.

Ssc5d - MPSS transcriptome analysis project

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTTTGGGCCATGTGT (ID_REF), GDS868, NM_173008

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7516854

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2065663219.

Ssc5d - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL3222, M300009832 (ID_REF), GDS1826, NM_173008

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20656632

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 851190920.

Ssc5d - Asthma and interleukin 13 (MOE430B)

Annotation:: Ssc5d, scavenger receptor cysteine rich family, 5 domains

Organism:: Mus musculus

Reporter:: GPL340, 1439529_at (ID_REF), GDS959, 269855 (Gene ID), AI845825

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 8511909

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 269855) (997)
GEO Profiles
Bone Marrow Cells
Bone Marrow Cells
Cells contained in the bone marrow including fat cells (see ADIPOCYTES); STROMAL CELLS; MEGAKARYOCYTES; and the immediate precursors of most blood cells....<br/>Year introduced: 1998(1966)

MeSH
Synthetic construct Mus musculus clone IMAGE:100062187, MGC:190402 poly (A) poly...
Synthetic construct Mus musculus clone IMAGE:100062187, MGC:190402 poly (A) polymerase alpha (Papola) mRNA, encodes complete protein
gi|162318631|gb|BC156654.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 997

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity