GEO Profile Links for Gene (Select 246696) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1466

<< First< Prev

Page of 74

Next >Last >>

Select item 866825821.

Slc25a28 - All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL1261, 1424776_a_at (ID_REF), GDS4294, 246696 (Gene ID), BC025908

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 86682582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1262296862.

Slc25a28 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS5436, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126229686

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75224823.

Slc25a28 - MPSS transcriptome analysis project

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCTCCACAGCCATCG (ID_REF), GDS868, NM_145156

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522482

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1277135864.

Slc25a28 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS5520, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127713586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1213968575.

Slc25a28 - Negative elongation factor B subunit deficiency effect on the heart

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2722623 (ID_REF), GDS5302, NM_145156

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121396857

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 573555066.

Slc25a28 - Kras G12D heterozygous mutation effect on somatic cell line (Sentrix MouseRef-8)

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL4865, scl52458.4_47-S (ID_REF), GDS3456, NM_145156

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 57355506

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318113867.

Slc25a28 - Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS5822, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131811386

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1317646868.

Slc25a28 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS5821, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131764686

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625911379.

Slc25a28 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6333, scl52458.4_47-S (ID_REF), GDS3621, NM_145156, Slc25a28 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62591137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5962634610.

Slc25a28 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2722623 (ID_REF), GDS3522, NM_145156

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59626346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 595297211.

Slc25a28 - High fat diet effect on aorta: time course

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL891, 3672 (ID_REF), GDS735, AK155044, A_51_P400396 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5952972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12260858612.

Slc25a28 - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS5342, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122608586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10326298613.

Slc25a28 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS4795, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103262986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7659608214.

Slc25a28 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL1261, 1424776_a_at (ID_REF), GDS4034, 246696 (Gene ID), BC025908

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76596082

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7566193115.

Slc25a28 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6481, 6590600 (ID_REF), GDS4002, NM_145156, Slc25a28 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75661931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7277578616.

Slc25a28 - Intestinal microbiota depletion effect on colon epithelial cells

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2722623 (ID_REF), GDS3921, NM_145156, SLC25A28 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 72775786

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5483378217.

Slc25a28 - Helicobacter pylori infection effect on a gastric epithelial progenitor cell line

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL1261, 1424776_a_at (ID_REF), GDS3346, 246696 (Gene ID), BC025908

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 54833782

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5462907518.

Slc25a28 - Skin carcinogenesis model

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL4234, 6590600 (ID_REF), GDS3334, NM_145156

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54629075

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4819927519.

Slc25a28 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL4234, 6590600 (ID_REF), GDS3086, NM_145156

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48199275

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12575155720.

Slc25a28 - Commensal bacteria colonization effect on gnotobiotic model of food allergy: colonic epithelial cells

Annotation:: Slc25a28, solute carrier family 25, member 28

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2722623 (ID_REF), GDS5424, NM_145156

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125751557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 74

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 246696) (1466)
GEO Profiles
protein PLASTID TRANSCRIPTIONALLY ACTIVE 14 isoform X1 [Vitis vinifera]
protein PLASTID TRANSCRIPTIONALLY ACTIVE 14 isoform X1 [Vitis vinifera]
gi|731371752|ref|XP_010649327.1|

Protein
Staphylococcus simulans strain SNUC 1713 contig028, whole genome shotgun sequenc...
Staphylococcus simulans strain SNUC 1713 contig028, whole genome shotgun sequence
gi|1378597367|ref|NZ_PZGD01000028.1 |WGS:NZ_PZGD01|contig028

Nucleotide
Staphylococcus simulans strain SNUC 3770 contig091, whole genome shotgun sequenc...
Staphylococcus simulans strain SNUC 3770 contig091, whole genome shotgun sequence
gi|1378584362|ref|NZ_PZFW01000091.1 |WGS:NZ_PZFW01|contig091

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1466

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity