GEO Profile Links for Gene (Select 20521) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2287

<< First< Prev

Page of 115

Next >Last >>

Select item 644807841.

Slc22a12 - Hypertension model: kidney

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL9734, 100107661_TGI_at (ID_REF), GDS3675, NM_009203

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64480784

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 556576042.

Slc22a12 - Dent disease model: renal proximal tubules

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422898_s_at (ID_REF), GDS3397, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55657604

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76760263.

Slc22a12 - X-linked hypophosphatemia and low phosphate diet

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL81, 102429_at (ID_REF), GDS879, 20521 (Gene ID), AB005451

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 7676026

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26289264.

Slc22a12 - Type 2 diabetes and renal function

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL81, 102429_at (ID_REF), GDS402, 20521 (Gene ID), AB005451

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 2628926

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1050145135.

Slc22a12 - Colistin effect on the kidney

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1251401 (ID_REF), GDS4834, NM_009203, SLC22A12 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 105014513

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1037235046.

Slc22a12 - Pan-peroxisome proliferator-activated receptor agonist effect on various tissues: dose response

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422898_s_at (ID_REF), GDS4806, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 103723504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 874437047.

Slc22a12 - Heart, kidney and lung during juvenile growth

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422898_s_at (ID_REF), GDS4316, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 40 samples

ID:: 87443704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 556576038.

Slc22a12 - Dent disease model: renal proximal tubules

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422897_at (ID_REF), GDS3397, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55657603

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 552027939.

Slc22a12 - Iron enriched and deficient diets effect on the liver

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL4134, 30493 (ID_REF), GDS3373, NM_009203, A_51_P335519 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55202793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3881569210.

Slc22a12 - Pubertal mammary gland development

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL339, 1422897_at (ID_REF), GDS2721, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38815692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749743411.

Slc22a12 - MPSS transcriptome analysis project

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGATGACTGCAGTGG (ID_REF), GDS868, NM_009203

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7497434

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12541224812.

Slc22a12 - Model for Wilms tumor of the kidney: time course

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1251401 (ID_REF), GDS5415, NM_009203

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125412248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9052910413.

Slc22a12 - HIV-associated nephropathy model: kidney

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422898_s_at (ID_REF), GDS4220, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 90529104

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6227661314.

Slc22a12 - Claudin16 deficiency effect on kidneys

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1251401 (ID_REF), GDS3612, NM_009203, SLC22A12 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62276613

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5506502615.

Slc22a12 - Fibroblast growth factor-23 transgenic model

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL81, 102429_at (ID_REF), GDS3361, 20521 (Gene ID), AB005451

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 55065026

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3187525816.

Slc22a12 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL2872, 858 (ID_REF), GDS2413, NM_009203, A_51_P335519 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31875258

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2393069317.

Slc22a12 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430A)

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL339, 1422898_s_at (ID_REF), GDS2030, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 23930693

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4986120418.

Slc22a12 - Various tissues

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL1261, 1422898_s_at (ID_REF), GDS3142, 20521 (Gene ID), NM_009203

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49861204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1561168619.

Slc22a12 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Slc22a12, Solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL2727, 26752 (ID_REF), GDS1527, AV002192, 0610015M04 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15611686

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 732942620.

Slc22a12 - Corneal stromal cell differentiation

Annotation:: Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12

Organism:: Mus musculus

Reporter:: GPL81, 102429_at (ID_REF), GDS857, 20521 (Gene ID), AB005451

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 7329426

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 115

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 20521) (2287)
GEO Profiles
Egr2 early growth response 2 [Mus musculus]
Egr2 early growth response 2 [Mus musculus]
Gene ID:13654

Gene
Gene Links for GEO Profiles (Select 97872138) (1)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2287

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity