 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 22, 2024 |
| Title |
rrp4/urt1/heso1_rep3 |
| Sample type |
SRA |
| |
|
| Source name |
inflorescences
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: inflorescences
genotype: rrp4-2/urt1-1/heso1-4
|
| Growth protocol |
All seeds were sterilized and germinated on plates containing 1x Murashige & Skoog medium (#M0222.0050, Saveen og Werner ApS, Denmark), supplemented with 1% (w/v) sucrose and 0.8% (w/v) agar. Seedlings were transferred to soil (Plugg/Såjord [seedcompost]; SW Horto, Bramming, Denmark) 10 days after germination (DAG). After transfer to soil, plants were grown in a Percival growth chamber for an additional 4 weeks under the following conditions: 16 h light (Master TL-D 36W/840 and 18W/840 bulbs (Philips); 130 mmol m−2 s−1, 21°C, 60% relative humidity)/ 8 h darkness (16°C, 60% relative humidity).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Inflorescences and rosettes for northern blots, western blots and sequencing libraries were collected and snap-frozen in liquid nitrogen. Total RNA from inflorescences was extracted with TRI Reagent (#T9424, Sigma-Aldrich Denmark A/S) according to the manufacturer’s instructions. The RNA was dissolved in nuclease-free water.
1 μg of total inflorescence RNA was used as input in each library. Libraries were generated using the NEBNext Multiplex Small RNA Library Prep Set (#E7300S, New England Biolabs) according to the manufacturer’s instructions. The indexed cDNA libraries were size selected on a 6% polyacrylamide gel as described in the NEBNext protocol. All size-selected libraries were analyzed using an Agilent Bioanalyzer, quantified with Qubit measurements (#Q32854, Invitrogen) and single-end sequenced on an Illumina Nextseq 500 with SE75_HI chemistry (#FC-404-2005, Illumina). 1% of spike-in PhiX Control v3 (#15017666, Illumina) was also loaded.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
sRNAseq libraries
|
| Data processing |
The adaptor sequence, AGATCGGAAGAG CACACGTCTGAACTCCAGTCAC, was trimmed from raw reads with cutadapt v.2.4
Reads were mapped with STAR 2.6.0a to TAIR10 with the following parameters: outFilterMultimapNmax 20, alignIntronMax 1, outFilterMismatchNmax 1, outFilterMismatchNoverL max 0, outFilterScoreMinOverLread 0, outFilterMatchN minOverLread 0, outFilterMatchNmin 15, alignSJDBover hangMin 100. No rRNA or tRNA reads were removed prior to mapping.
Mapped reads were quanti!ed with featureCounts from subread-1.6.3 with an Araport11 transcriptome reference !le custom modi!ed to also include intergenic regions.
The package DESeq2 was used for the differential expression analysis. Normalized reads were estimated for size factors and a generalized linear model was used. The DESeq2 results were extracted with manual contrasting of mutant versus WT. A gene was considered to have differentially expressed small RNA levels compared to WT if the Padj < 0.05 as assessed by Wald’s tests.
Assembly: TAIR10 genome was indexed with Arabidopsis_thaliana.TAIR10.49.gff3
Supplementary files format and content: the xlsx file contains the following columns (gene, baseMean, log2FoldChange, pvalue, padj, locus_type, genotype)
|
| |
|
| Submission date |
May 20, 2024 |
| Last update date |
May 22, 2024 |
| Contact name |
Peter Brodersen |
| E-mail(s) |
pbrodersen@bio.ku.dk
|
| Organization name |
University of Copenhagen
|
| Street address |
Ole Maaløes Vej 5
|
| City |
København N |
| ZIP/Postal code |
2200 |
| Country |
Denmark |
| |
|
| Platform ID |
GPL19580 |
| Series (1) |
| GSE267947 |
Terminal nucleotidyl transferases govern secondary siRNA production at distinct steps in plants |
|
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8282375_rrp4urt1heso1_R3.fastq.gz |
535.9 Mb |
(ftp)(http) |
FASTQ |
| Raw data are available in SRA |
|
|
|
|
 |
