GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM8282362

Query DataSets for GSM8282362

Status

Public on May 22, 2024

Title

urt1-1_rep2

Sample type

SRA

Source name

inflorescences

Organism

Arabidopsis thaliana

Characteristics

tissue: inflorescences
genotype: urt1-1

Growth protocol

All seeds were sterilized and germinated on plates containing 1x Murashige & Skoog medium (#M0222.0050, Saveen og Werner ApS, Denmark), supplemented with 1% (w/v) sucrose and 0.8% (w/v) agar. Seedlings were transferred to soil (Plugg/Såjord [seedcompost]; SW Horto, Bramming, Denmark) 10 days after germination (DAG). After transfer to soil, plants were grown in a Percival growth chamber for an additional 4 weeks under the following conditions: 16 h light (Master TL-D 36W/840 and 18W/840 bulbs (Philips); 130 mmol m−2 s−1, 21°C, 60% relative humidity)/ 8 h darkness (16°C, 60% relative humidity).

Extracted molecule

total RNA

Extraction protocol

Inflorescences and rosettes for northern blots, western blots and sequencing libraries were collected and snap-frozen in liquid nitrogen. Total RNA from inflorescences was extracted with TRI Reagent (#T9424, Sigma-Aldrich Denmark A/S) according to the manufacturer’s instructions. The RNA was dissolved in nuclease-free water.
1 μg of total inflorescence RNA was used as input in each library. Libraries were generated using the NEBNext Multiplex Small RNA Library Prep Set (#E7300S, New England Biolabs) according to the manufacturer’s instructions. The indexed cDNA libraries were size selected on a 6% polyacrylamide gel as described in the NEBNext protocol. All size-selected libraries were analyzed using an Agilent Bioanalyzer, quantified with Qubit measurements (#Q32854, Invitrogen) and single-end sequenced on an Illumina Nextseq 500 with SE75_HI chemistry (#FC-404-2005, Illumina). 1% of spike-in PhiX Control v3 (#15017666, Illumina) was also loaded.

Library strategy

ncRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina NextSeq 500

Description

sRNAseq libraries

Data processing

The adaptor sequence, AGATCGGAAGAG CACACGTCTGAACTCCAGTCAC, was trimmed from raw reads with cutadapt v.2.4
Reads were mapped with STAR 2.6.0a to TAIR10 with the following parameters: outFilterMultimapNmax 20, alignIntronMax 1, outFilterMismatchNmax 1, outFilterMismatchNoverL max 0, outFilterScoreMinOverLread 0, outFilterMatchN minOverLread 0, outFilterMatchNmin 15, alignSJDBover hangMin 100. No rRNA or tRNA reads were removed prior to mapping.
Mapped reads were quanti!ed with featureCounts from subread-1.6.3 with an Araport11 transcriptome reference !le custom modi!ed to also include intergenic regions.
The package DESeq2 was used for the differential expression analysis. Normalized reads were estimated for size factors and a generalized linear model was used. The DESeq2 results were extracted with manual contrasting of mutant versus WT. A gene was considered to have differentially expressed small RNA levels compared to WT if the Padj < 0.05 as assessed by Wald’s tests.
Assembly: TAIR10 genome was indexed with Arabidopsis_thaliana.TAIR10.49.gff3
Supplementary files format and content: the xlsx file contains the following columns (gene, baseMean, log2FoldChange, pvalue, padj, locus_type, genotype)

Submission date

May 20, 2024

Last update date

May 22, 2024

Contact name

Peter Brodersen

E-mail(s)

pbrodersen@bio.ku.dk

Organization name

University of Copenhagen

Street address

Ole Maaløes Vej 5