|
| Status |
Public on Jun 30, 2020 |
| Title |
SW620_shFOXA2_1_1 |
| Sample type |
SRA |
| |
|
| Source name |
SW620 cell line
|
| Organism |
Homo sapiens |
| Characteristics |
chip antibody: none
tumor stage: Dukes' type C, colorectal adenocarcinoma
treatment: shFOXA2
|
| Treatment protocol |
A lentiviral U6-based expression vector containing PuroR-T2A-mCherry was used to express shRNAs. The lentiviral vector was digested by BsmbI, followed by annealed shRNA oligos insertion, to clone shRNA expression plasmids. We used two shRNA targeting sites against FOXA2, as follows: FOXA2-shRNA1: 5’ GAACGGCATGAACACGTACAT 3’ (from Sigma-Aldrich Corporation, TRCN0000014915); FOXA2-shRNA2: 5’ GCAAGGGAGAAGAAATCCATA 3’, as previously described38. shControl: 5’ CAACAAGATGAAGAGCACCAA 3’. Lentiviral vector particles were produced by tri-transfection of plasmids harboring the packaging construct, the transfer vector and the envelope-expressing construct into 293T cells using DNAfect reagents (Cwbio Cat. No. CW0806). Viral supernatants were harvested and used for infections or stored at -80°C. Stable FOXA2 knockdown cell lines were generated by using lentiviral U6-based expression vectors. Stable populations were selected with 2 μg/ml puromycin (Sigma-Aldrich Cat. No. P9620). Knockdown was confirmed by RT-qPCR and western blotting.
|
| Growth protocol |
SW480 and SW620 cell lines were obtained from China Infrastruture of Cell Line Resources and cultured as described37. Briefly, SW480 and SW620 cells were cultured in DMEM (Gibco Cat. No. C11995500BT) supplemented with 10% fetal bovine serum (Gemini Cat. No. 900-108) and 1% penicillin/streptomycin (Gibco Cat. No. 15140-122). Cells were cultured at 37°C with 5% CO2. Cells used to inject mice were stably transfected with luciferase.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA-sequencing (RNA-seq) libraries were prepared by using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB Cat. No. E7420), according to the manufacturer’s instructions.
The sequencing was performed by Hiseq1500 (Illumina).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
replicate 1
|
| Data processing |
The fastq files from RNA-seq experiments were mapped to the human genome (hg19) by using STAR41 with parameters --outFilterMismatchNoverLmax 0.05.
To measure expression, we calculated the raw counts for each gene by using the analyzeRepeats command from HOMER (http://homer.salk.edu/homer/) with the option “rna” and the default parameters.
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text files include read count and RPKM values for each Sample
|
| |
|
| Submission date |
Nov 15, 2017 |
| Last update date |
Jun 30, 2020 |
| Contact name |
Yang Eric Li |
| E-mail(s) |
liyang01133@gmail.com
|
| Phone |
+1-8589222580
|
| Organization name |
Tsinghua University
|
| Department |
School of Life Sciences
|
| Lab |
Zhi John Lu
|
| Street address |
Room 2-110, Biotechnology Building, School of Life Sciences, Tsinghua University
|
| City |
Beijing |
| State/province |
Beijing |
| ZIP/Postal code |
100084 |
| Country |
China |
| |
|
| Platform ID |
GPL18460 |
| Series (2) |
| GSE106920 |
Tissue-specific transcription reprogramming promotes liver metastasis of colorectal cancer (RNA-Seq) |
| GSE106923 |
Tissue-specific transcription reprogramming promotes liver metastasis of colorectal cancer |
|
| Relations |
| BioSample |
SAMN08027780 |
| SRA |
SRX3394257 |
