GEO Profiles Links for Nucleotide (Select 162287211) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 342

<< First< Prev

Page of 18

Next >Last >>

Select item 215638121.

Mycn - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL1942, 13812 (ID_REF), GDS1882, NM_008709

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21563812

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971537782.

Mycn - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL9734, 100112907_TGI_at (ID_REF), GDS4495, NM_008709

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97153778

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316552853.

Mycn - Normal liver developmental stages: embryonic and postnatal

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P536494 (ID_REF), GDS5818, NM_008709, A_52_P536494 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131655285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715537854.

Mycn - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P536494 (ID_REF), GDS3890, NM_008709, A_52_P536494 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71553785

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1304464055.

Mycn - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P497332 (ID_REF), GDS5666, NM_008709, A_51_P497332 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130446405

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529685666.

Mycn - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL2872, 22166 (ID_REF), GDS3259, NM_008709, A_52_P536494 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52968566

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728519857.

Mycn - Spatial and temporal development of mammalian salivary glands

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P536494 (ID_REF), GDS3922, NM_008709, A_52_P536494 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72851985

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 721111288.

Mycn - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS3904, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72111128

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 826739289.

Mycn - Pluripotent embryonic stem cells and multipotent adult germline stem cells in 129SV and Stra8-EGFP/Rosa26-LacZ strains

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS4170, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 82673928

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749160510.

Mycn - MPSS transcriptome analysis project

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGGTAGGGGGCAGGA (ID_REF), GDS868, NM_008709

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7491605

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 10783682811.

Mycn - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS4944, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107836828

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10921106612.

Mycn - Diabetic db/db heart response to rosiglitazone

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL4134, 1166 (ID_REF), GDS4990, NM_008709, A_52_P536494 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109211066

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11584922813.

Mycn - Neuro2a neuroblastoma cell lines: anchorage dependent cells and anchorage independent tumorspheres

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS5140, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 115849228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6749532814.

Mycn - Early-passage induced pluripotent stem (iPS) cells derived from various somatic cell populations

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS3770, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 67495328

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13163960515.

Mycn - Normal liver developmental stages: embryonic and postnatal

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P497332 (ID_REF), GDS5818, NM_008709, A_51_P497332 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131639605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5538099416.

Mycn - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL891, 5294 (ID_REF), GDS3386, NM_008709, A_51_P497332 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55380994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7554472817.

Mycn - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS3999, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75544728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10923417918.

Mycn - Diabetic db/db heart response to rosiglitazone

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL4134, 24279 (ID_REF), GDS4990, NM_008709, A_51_P497332 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109234179

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8477152819.

Mycn - Activated Autoimmune Regulator (AIRE)-deficient, CD8+CD28low regulatory T lymphocytes

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS4373, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 84771528

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12474502820.

Mycn - RANKL effect on osteoclastogenic cell line

Annotation:: Mycn, v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived

Organism:: Mus musculus

Reporter:: GPL6246, 10399421 (ID_REF), GDS5398, NM_008709, BC005453, BC049783, M36277, chr12:12936093-12941708 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 124745028

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 18

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 162287211) (342)
GEO Profiles
Component(Core) Links for Nucleotide (Select 162287211) (2)
Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 342

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity