GEO Profile Links for Gene (Select 66935) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 56564821.

Cir1 - Spermatogonial stem cell activity in testis laminin binding germ cells (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS701, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 5656482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26752822.

Cir1 - Spermatogenesis time course (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS409, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2675282

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201707813.

Cir1 - Age effect on hematopoietic stem cells

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1423375_at (ID_REF), GDS1803, 66935 (Gene ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20170781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47807824.

Cir1 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS606, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4780782

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 78994125.

Cir1 - Aquaporin-1 knockout kidney inner medulla profile (I)

Annotation:: Cir1, Corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1104, H3028G12 (ID_REF), GDS899, BG065239

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 7899412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1047001456.

Cir1 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521589 (ID_REF), GDS4827, NM_025854, BC012219, BC099444, chr5:40328444-40329427 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104700145

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 184097357.

Cir1 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL2623, M200004535 (ID_REF), GDS1707, NM_025854

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18409735

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940008818.

Cir1 - Gonadal development: ovaries and testes

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1423375_at (ID_REF), GDS4503, 66935 (Gene ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94000881

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1046960059.

Cir1 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL6246, 10483667 (ID_REF), GDS4827, NM_025854, BC012219, BC099444, chr2:73283872-73312567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104696005

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4242958110.

Cir1 - Taf7l deficiency effect on the testis

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1423375_at (ID_REF), GDS2857, 66935 (Gene ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42429581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2952178211.

Cir1 - Uniparental duplication of chromosome 7 regions effect on various tissues (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS2284, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 29521782

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2359028212.

Cir1 - Lupus-prone BWF1 males and females: spleen (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS2012, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 23590282

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10785004513.

Cir1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521589 (ID_REF), GDS4944, NM_025854, BC012219, BC099444, chr5:40328444-40329427 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107850045

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3533022014.

Cir1 - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Cir1, Corepressor interacting with RBPJ, 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL922, 8020 (ID_REF), GDS2571, H3028G12 (CLONE ID), A_65_P06633 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35330220

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2731898215.

Cir1 - Type 1 diabetes model: autoimmune target organs (MG-U74B)

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL82, 162572_i_at (ID_REF), GDS2178, 66935 (Gene ID), AW108550

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27318982

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6185478116.

Cir1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1423375_at (ID_REF), GDS3596, 66935 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61854781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2159481017.

Cir1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1942, 44810 (ID_REF), GDS1882, NM_025854

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21594810

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746974618.

Cir1 - MPSS transcriptome analysis project

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCATCACAGGACTATGT (ID_REF), GDS868, NM_025854

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7469746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784590519.

Cir1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL6246, 10483667 (ID_REF), GDS4944, NM_025854, BC012219, BC099444, chr2:73283872-73312567 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107845905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3143638120.

Cir1 - Male germ cells

Annotation:: Cir1, corepressor interacting with RBPJ, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1423375_at (ID_REF), GDS2390, 66935 (Gene ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31436381

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 66935) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity