GEO Profile Links for Gene (Select 622139) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 642

<< First< Prev

Page of 33

Next >Last >>

Select item 982412001.

Clca4c-ps - CD11c+ dendritic cell depletion effect on Herpes simplex virus-1 infection of cornea

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4537, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 98241200

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 171224002.

Clca4c-ps - Myocilin over-secretion effect on the retina

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS1640, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 17122400

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 326088003.

Clca4c-ps - Limbal and central corneal epithelial basal cell comparison

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS2433, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32608800

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 890326004.

Clca4c-ps - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4408, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89032600

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 543848005.

Clca4c-ps - Na+/H+ exchanger 3 deficiency effect on the colon

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS3323, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 54384800

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 280559006.

Clca4c-ps - Flagellin effect on toll-like receptor 5 deficient intestinal epithelial cells

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS2211, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 28055900

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 280094007.

Clca4c-ps - Spinal cord and dorsal root ganglion

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS2209, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28009400

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1166150008.

Clca4c-ps - Caspase-8 defieciency effect on intestinal epithelial cells

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS5182, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 116615000

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 726265009.

Clca4c-ps - Various central nervous system regions of adult inbred strain

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS3917, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 102 samples

ID:: 72626500

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8469100010.

Clca4c-ps - Effect of macrophage-specific peroxisome proliferator-activated receptor-gamma deficiency on induced inflammatory bowel disease

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4370, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 84691000

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8457110011.

Clca4c-ps - Azoxymethane/dextran sulfate sodium-induced ulcerative colitis-associated colorectal cancer model: time course

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4367, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 84571100

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8353270012.

Clca4c-ps - Dietary saturated fat effect on small intestine

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4339, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 83532700

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8223660013.

Clca4c-ps - Retinal pigment epithelium (RPE) response to light damage

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS3412, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82236600

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10223870014.

Clca4c-ps - Pancreatic cancer model: saliva supernatant

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4767, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 102238700

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7046750015.

Clca4c-ps - Dextran sodium sulfate-induced colitis model: time course

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS3859, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 70467500

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9448670016.

Clca4c-ps - EphB2-selected populations of intestinal crypt cells

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4514, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 94486700

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8437520017.

Clca4c-ps - CD4CD45Rbhi T-cell transfer colitis model: time course

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4363, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 84375200

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2035310018.

Clca4c-ps - Graded HoxA10 expression effect on Lin(-) Sca1(+) c-kit(+) bone marrow cells

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS1809, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 20353100

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8452460019.

Clca4c-ps - Metalloprotease ADAMTS-12 deficiency effect on DSS-induced colitis: distal colon

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1261, 1447394_at (ID_REF), GDS4366, 622139 (Gene ID), BB750818

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 84524600

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 748120320.

Clca4c-ps - MPSS transcriptome analysis project

Annotation:: Clca4c-ps, chloride channel accessory 4C, pseudogene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGCTGTGCCAGAAGA (ID_REF), GDS868, BB750818

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7481203

GEO DataSets Gene Chromosome neighbors

<< First< Prev

Page of 33

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 622139) (642)
GEO Profiles
phosphopentomutase [Staphylococcus aureus subsp. aureus ED98]
phosphopentomutase [Staphylococcus aureus subsp. aureus ED98]
gi|269201791|gnl|REF_ed98|SAAV_0107 YP_003281060.1|

Protein
MULTISPECIES: hypothetical protein [Vibrio]
MULTISPECIES: hypothetical protein [Vibrio]
gi|500802716|ref|WP_011998832.1|

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 642

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity