GEO Profile Links for Gene (Select 58207) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 1065422941.

Slc43a3 - Age effect on skeletal muscle precursor cells

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS4892, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 106542294

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318674542.

Slc43a3 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS5824, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131867454

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969702543.

Slc43a3 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS4490, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96970254

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064327544.

Slc43a3 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS4886, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106432754

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766726945.

Slc43a3 - Rosiglitazone effect on streptozotocin-induced diabetic DBA/2J mice: perpheral sciatic nerve

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS4036, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 76672694

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1301727946.

Slc43a3 - Early postnatal skeletal muscle stem cells: time course

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS5660, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 130172794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596310447.

Slc43a3 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2651651 (ID_REF), GDS3522, NM_021398

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59631044

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1302255688.

Slc43a3 - Interleukin 7 and FLT-3 ligand effect on EML1 HSPC line expressing acute lymphoblastic leukemia TEL-AML1 fusion protein: time course

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL11533, 10473384 (ID_REF), GDS5661, NM_021398, AF188622, chr2:84776817-84798113 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130225568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 404194949.

Slc43a3 - Endothelial cell response to chronic activation by tumor necrosis factor

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS2773, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 40419494

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6185419410.

Slc43a3 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS3596, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61854194

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6231609411.

Slc43a3 - Luteolin effect on pro-inflammatory challenged microglial cell line

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS3613, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 62316094

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2798479412.

Slc43a3 - Spinal cord and dorsal root ganglion

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS2209, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 27984794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8668059413.

Slc43a3 - All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS4294, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 86680594

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6919249414.

Slc43a3 - SP-C/c-raf transgenic model of lung cancer: dysplasia

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS3825, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 69192494

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10659535415.

Slc43a3 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS4893, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106595354

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6835579416.

Slc43a3 - Lung response to chronic and acute exposure to ingested arsenic

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS3801, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 55 samples

ID:: 68355794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10676915417.

Slc43a3 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS4898, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106769154

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10893689418.

Slc43a3 - Adriamycin in vitro effect on Eµ-myc transgenic lymphoma cells deficient in Suv39h1

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1422788_at (ID_REF), GDS4983, 58207 (Gene ID), NM_021398

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 108936894

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747645419.

Slc43a3 - MPSS transcriptome analysis project

Annotation:: Slc43a3, Solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAACTGACTGGCTAGC (ID_REF), GDS868, AV227510

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476454

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12961495420.

Slc43a3 - Retinoblastoma ∆G/∆G mutant allele effect on quiescent embryonic fibroblasts

Annotation:: Slc43a3, solute carrier family 43, member 3

Organism:: Mus musculus

Reporter:: GPL6246, 10473384 (ID_REF), GDS5641, NM_021398, XM_006499959, AF188622, BC089603, AK086962, chr2:84936660-84957956 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 129614954

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 58207) (1000)
GEO Profiles
Mus musculus intersectin 2, mRNA (cDNA clone MGC:169886 IMAGE:8861281), complete...
Mus musculus intersectin 2, mRNA (cDNA clone MGC:169886 IMAGE:8861281), complete cds
gi|187952854|gb|BC138262.1|

Nucleotide
Protein-tyrosine kinase erbB (version 1) - Chicken #EC-number 2.7.1.112
Protein-tyrosine kinase erbB (version 1) - Chicken #EC-number 2.7.1.112
gi|66824|pir||TVCHLV

Protein
Mus musculus targeted KO-first, conditional ready, lacZ-tagged mutant allele Ras...
Mus musculus targeted KO-first, conditional ready, lacZ-tagged mutant allele Rassf9:tm1a(KOMP)Wtsi tm1a(KOMP)Ucd; transgenic
gi|354790069|gb|JN954570.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity