GEO Profile Links for Gene (Select 243376) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 316

<< First< Prev

Page of 16

Next >Last >>

Select item 74737991.

Doxl2 - MPSS transcriptome analysis project

Annotation:: Doxl2, Diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGGGGCAGGGTCT (ID_REF), GDS868, BY755446

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7473799

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 824729772.

Doxl2 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1222506 (ID_REF), GDS3720, NM_001029987

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82472977

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1087061143.

Doxl2 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS4973, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108706114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1186400494.

Doxl2 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1222506 (ID_REF), GDS5237, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118640049

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 847263145.

Doxl2 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS4371, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84726314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 990499146.

Doxl2 - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS4556, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99049914

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1050674147.

Doxl2 - Transcription factor treatment effect on embryonic fibroblasts

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS4835, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 28 samples

ID:: 105067414

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1210068498.

Doxl2 - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1222506 (ID_REF), GDS5293, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 121006849

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1167478489.

Doxl2 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2987657 (ID_REF), GDS5185, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116747848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11674784910.

Doxl2 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1222506 (ID_REF), GDS5185, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116747849

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10470181411.

Doxl2 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS4827, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104701814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6197933712.

Doxl2 - Eset depletion effect on embryonic stem cell

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6333, GI_38084196-S (ID_REF), GDS3599, XM_144674, LOC243376 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61979337

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6257973713.

Doxl2 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6333, GI_38084196-S (ID_REF), GDS3621, XM_144674, LOC243376 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62579737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11651859214.

Doxl2 - B-cell leukemia/lymphoma 11B overexpression effect on brain striatal cells in vitro

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1222506 (ID_REF), GDS5180, XM_144674

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116518592

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11864004815.

Doxl2 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2987657 (ID_REF), GDS5237, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118640048

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4822293616.

Doxl2 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL4234, 104780056 (ID_REF), GDS3086, XM_144674

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48222936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13223354917.

Doxl2 - High-fat diet effect on brown adipose tissue development

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1222506 (ID_REF), GDS6000, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132233549

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4601103618.

Doxl2 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL4234, 104780056 (ID_REF), GDS2993, XM_144674

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 46011036

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11606291419.

Doxl2 - Bcl6 deficiency effect on regulatory T cell

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10538174 (ID_REF), GDS5161, NM_001029987, AK144307, BC150935, chr6:48975143-48978745 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116062914

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12984234920.

Doxl2 - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Doxl2, diamine oxidase-like protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1222506 (ID_REF), GDS5648, NM_001029987, DOXL2 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129842349

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 243376) (316)
GEO Profiles
The relationship between the extent of collaboration of general practitioners an...
The relationship between the extent of collaboration of general practitioners and pharmacists and the implementation of recommendations arising from medication review: a systematic review - Database of Abstracts of Reviews of Effects (DARE): Quality-assessed Reviews
Kidq7 kidney weight QTL 7 [Mus musculus]
Kidq7 kidney weight QTL 7 [Mus musculus]
Gene ID:492987

Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 316

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity