GEO Profile Links for Gene (Select 224813) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 931

<< First< Prev

Page of 47

Next >Last >>

Select item 74910211.

Lrrc73 - MPSS transcriptome analysis project

Annotation:: Lrrc73, Leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGTTCTCAGATGGT (ID_REF), GDS868, AI848334

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7491021

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 835875502.

Lrrc73 - Non-obese diabetic (NOD) and disease-resistant NOD.NOR-Chr4 models: splenic B cells

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS4340, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 83587550

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47804373.

Lrrc73 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS606, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4780437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 552731374.

Lrrc73 - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS3376, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55273137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26749375.

Lrrc73 - Spermatogenesis time course (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS409, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2674937

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158371506.

Lrrc73 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS5114, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115837150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194230267.

Lrrc73 - Chronic, low level drug exposure effect on obese liver

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P734742 (ID_REF), GDS5258, NM_001111142, A_52_P734742 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119423026

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 54343378.

Lrrc73 - Down syndrome and brain (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS682, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5434337

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273186379.

Lrrc73 - Type 1 diabetes model: autoimmune target organs (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS2178, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27318637

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 391693710.

Lrrc73 - Intestinal tract gene expression (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS522, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3916937

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1730303711.

Lrrc73 - POU-domain transcription factor Brn3a knockout effect on embryonic ganglia (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS1652, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 17303037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1735463712.

Lrrc73 - Dendritic cell subpopulations: spleen (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS1657, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17354637

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2947112613.

Lrrc73 - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL340, 1455755_at (ID_REF), GDS2281, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 29471126

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5058425014.

Lrrc73 - Transcription factor Ctip2 deficiency effect on brain striata

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS3178, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 50584250

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1468983715.

Lrrc73 - Transcription factor Tcf1 knockout effect on pancreatic islets (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS1474, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14689837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2801775016.

Lrrc73 - Spinal cord and dorsal root ganglion

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS2209, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28017750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13233642617.

Lrrc73 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P734742 (ID_REF), GDS6016, NM_001111142, A_52_P734742 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132336426

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1723555018.

Lrrc73 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS1647, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17235550

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3035003719.

Lrrc73 - Acute myocardial infarction model: time course (MG-U74B)

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL82, 116976_at (ID_REF), GDS2330, 224813 (Gene ID), AI848334

DataSet type:: Expression profiling by array, count, 66 samples

ID:: 30350037

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7662705020.

Lrrc73 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Lrrc73, leucine rich repeat containing 73

Organism:: Mus musculus

Reporter:: GPL1261, 1455755_at (ID_REF), GDS4034, 224813 (Gene ID), BB026554

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76627050

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 47

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 931

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity