GEO Profile Links for Gene (Select 105653) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 981

<< First< Prev

Page of 50

Next >Last >>

Select item 166539271.

Phyhip - Inbred Long Sleep and Inbred Short Sleep model of ethanol sensitivity: cerebellum (MG-430B)

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL340, 1455463_at (ID_REF), GDS1610, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 16653927

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 464018272.

Phyhip - Hedgehog-induced medulloblastoma model (MG-430B)

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL340, 1455463_at (ID_REF), GDS3009, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 46401827

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74792833.

Phyhip - MPSS transcriptome analysis project

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGGAACTATGTAGA (ID_REF), GDS868, NM_145981

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7479283

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441758334.

Phyhip - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL891, 10133 (ID_REF), GDS2924, BC030494, A_51_P368210 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44175833

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 335473275.

Phyhip - Ras-associated binding protein 3A mutations effect on brain cortices and hippocampi (MG-430B)

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL340, 1455463_at (ID_REF), GDS2483, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 33547327

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 232013466.

Phyhip - Primary visual cortex response to visual input deprivation (MG-U74B)

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL82, 117097_at (ID_REF), GDS1984, 105653 (Gene ID), AW049870

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23201346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968268647.

Phyhip - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL6246, 10416273 (ID_REF), GDS4486, NM_145981, XM_006518379, XM_006518380, BC030494, BC139360, chr14:70457517-70468824 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96826864

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 279645338.

Phyhip - Estradiol effect on the uterus: time course

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL891, 10133 (ID_REF), GDS2208, BC030494, A_51_P368210 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27964533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 432182589.

Phyhip - Cerebral cortex and hypothalamus response to sleep and sleep deprivation: time course

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS2882, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 90 samples

ID:: 43218258

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493223310.

Phyhip - Estren effect on the uterus: time course

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL891, 10133 (ID_REF), GDS2077, BC030494, A_51_P368210 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24932233

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12249355811.

Phyhip - Heat shock protein 90 inhibitor effect on Huntington’s disease model: brain striatum

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS5337, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122493558

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4547245812.

Phyhip - Vitamin E supplementation effect on aged brain

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS2973, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45472458

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5527324613.

Phyhip - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL82, 117097_at (ID_REF), GDS3376, 105653 (Gene ID), AW049870

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55273246

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1769553314.

Phyhip - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL891, 10133 (ID_REF), GDS1675, BC030494, A_51_P368210 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17695533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11916355815.

Phyhip - Striatal-enriched protein tyrosine phosphatase (STEP) knockout effect on striatum

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS5250, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 119163558

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9742526416.

Phyhip - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL6246, 10416273 (ID_REF), GDS4517, NM_145981, XM_006518379, XM_006518380, BC030494, BC139360, chr14:70457517-70468824 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97425264

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4136285817.

Phyhip - Morphine effect on the striatum

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS2815, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 41362858

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6194395818.

Phyhip - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS3598, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61943958

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6188685819.

Phyhip - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS3596, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61886858

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8848065820.

Phyhip - Niemann-Pick Type C disease brain: time course

Annotation:: Phyhip, phytanoyl-CoA hydroxylase interacting protein

Organism:: Mus musculus

Reporter:: GPL1261, 1455463_at (ID_REF), GDS4394, 105653 (Gene ID), BB427286

DataSet type:: Expression profiling by array, count, 27 samples

ID:: 88480658

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 105653) (981)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 981

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity