GEO Profile Links for Gene (Select 101943) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 61439941.

Sf3b3 - Blastocyst dormancy and activation comparison

Annotation:: Sf3b3, splicing factor 3b, subunit 3 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 7694 (ID_REF), GDS752, AK050772, AK088720, BC010595, BC021306, BC050220, CL212439, BC011412, H3052F04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6143994

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 824841812.

Sf3b3 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1237140 (ID_REF), GDS3720, NM_133953

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82484181

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268361573.

Sf3b3 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL6246, 10581674 (ID_REF), GDS5456, NM_133953, BC011412, BC025491, BC042580, BC139015, BC139016, AK046845, chr8:110810239-110846776 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126836157

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 197964164.

Sf3b3 - Protein tyrosine kinase Src R388A mutant rescue by imidazole in living cells: time course

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS1788, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 19796416

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 548250165.

Sf3b3 - Helicobacter pylori infection effect on a gastric epithelial progenitor cell line

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS3346, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 54825016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 663374166.

Sf3b3 - Transcription factor SRF deletion effect on hematopoietic stem cells

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS3732, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 66337416

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553993167.

Sf3b3 - Chromatin remodeling component BAF250a deficiency effect on embryonic stem cells in vitro

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS3387, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 55399316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 145724168.

Sf3b3 - TGF-beta-activated kinase 1 deficient B cell response to B cell receptor stimulation

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS1467, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14572416

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 111201169.

Sf3b3 - SOCS3 inactivation effect on embryonic stem cells

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS1254, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 11120116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10778501610.

Sf3b3 - Telomere-associated protein Rif1 depletion effect on stem cell lines

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS4943, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 107785016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2575831611.

Sf3b3 - Spermatogonial stem cell self-renewal: time course

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS2112, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 25758316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11312671612.

Sf3b3 - An in vitro primordial germ cell specification system: time course

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS4870, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 113126716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2465481613.

Sf3b3 - Interleukin 2 deficient regulatory T cells expressing transcription factor Foxp3

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS2061, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 24654816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3751231614.

Sf3b3 - Embryonic J1 stem cell differentiation in vitro (MG-430A)

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL339, 1415985_at (ID_REF), GDS2668, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37512316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749420715.

Sf3b3 - MPSS transcriptome analysis project

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGAGGCTCAGAGT (ID_REF), GDS868, NM_133953

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7494207

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 447574316.

Sf3b3 - Zygotic gene activation

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL870, 6643 (ID_REF), GDS579, AK017529, AK046845, AK085705, AK088268, BC011412, BC025459, BC025491, H3029G03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4475743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6459921617.

Sf3b3 - Calreticulin deficiency effect on embryonic stem cell line

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS3680, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 64599216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12786299318.

Sf3b3 - Rhabdomyosarcoma model

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL6481, 3710044 (ID_REF), GDS5527, NM_133953, Sf3b3 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127862993

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2938301619.

Sf3b3 - Embryonic stem cell line response to the conditional expression of neurogenin 3

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS2276, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 29383016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10986561620.

Sf3b3 - Nonobese diabetic NOD spleen CD4 T-cells: 3-week old females

Annotation:: Sf3b3, splicing factor 3b, subunit 3

Organism:: Mus musculus

Reporter:: GPL1261, 1415985_at (ID_REF), GDS5019, 101943 (Gene ID), NM_133953

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 109865616

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 101943) (1000)
GEO Profiles
zinc finger protein 227 isoform X3 [Homo sapiens]
zinc finger protein 227 isoform X3 [Homo sapiens]
gi|2217322950|ref|XP_047295338.1|

Protein
Mus musculus splicing factor 3b, subunit 3 (Sf3b3), mRNA
Mus musculus splicing factor 3b, subunit 3 (Sf3b3), mRNA
gi|118498348|ref|NM_133953.2|

Nucleotide
Budesonide (Cortiment MMX)
Budesonide (Cortiment MMX)

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity