|
| Status |
Public on Oct 09, 2012 |
| Title |
Leaf 1 month plants |
| Sample type |
SRA |
| |
|
| Source name |
Leaf 1 month plants
|
| Organism |
Glycine max |
| Characteristics |
cultivar: PI462312
tissue and developemental stage: Leaf 1 month plants
|
| Treatment protocol |
Optimal greenhouse growth conditions
|
| Growth protocol |
Plants were grown in the greenhouse and tissues harvested from at least four plants of each line. Leaves and stems were harvested from two to four-week-old plants. Stem samples consisted of one centimeter size fragments immediately underneath the base of the unifoliate leaves. The leaf sample was made of first trifoliate sampled over the course of one week. Germinating cotyledons were harvested from two weeks old seedling. The very young whole seeds were collected 12-14 days after flowering.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Gel purification, cloning and sequencing of small RNAs from the multiple tissue samples was performed at Illumina Inc. (San Diego, CA) using the SBS (sequencing by synthesis) technology.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
PI462312
|
| Data processing |
Adapter trimming was performed using the first occurrences of substring TCG as the unique identifier for the beginning of the adapter (TCGTATGCCGTCTTCTGCTTG). The sizes of the small RNAs after adapter trimming ranged from 16 - 35 nt.
|
| |
|
| Submission date |
Mar 22, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Lila O. Vodkin |
| E-mail(s) |
l-vodkin@illinois.edu
|
| Phone |
217-244-6147
|
| Organization name |
University of Illinois
|
| Department |
Crop Sciences
|
| Lab |
Lila Vodkin
|
| Street address |
1201 W. Gregory Dr.
|
| City |
Urbana |
| State/province |
IL |
| ZIP/Postal code |
61801 |
| Country |
USA |
| |
|
| Platform ID |
GPL10267 |
| Series (1) |
| GSE36728 |
Divergent Patterns of Endogenous Small RNA Populations From Seed and Vegetative Tissues of Glycine max |
|
| Relations |
| SRA |
SRX131086 |
| BioSample |
SAMN00839324 |
