|
| Status |
Public on Dec 31, 2011 |
| Title |
kumo heterozygous |
| Sample type |
SRA |
| |
|
| Source name |
Ovarian tissue
|
| Organism |
Drosophila melanogaster |
| Characteristics |
strain: kumoM41-13/TM3
tissue: Ovaries
|
| Growth protocol |
25 degree Centigrade
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Trizol Phenol/chloroform extraction. Small RNA were isolated by size fractionation and were ligated to adapter 5'TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG 3'. Reverse transcription and PCR was followed as per manufacturer's instructions. Purified amplicons were sequenced on Illumina Genome Analyzer II.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
The adapter sequences were removed from the reads and the resulting clipped small RNA sequences were mapped to the Release 5 genome. We ignored the sequences matching to the Uextra region of drosophila genome. Only reads matching to the fly genome without any mismatches were accounted. small RNA counts were normalized to small non-coding RNAs. For the piRNA analysis, small RNAs, which exceeded 22 nt in length and did not match any other defined class of small RNAs such as miRNA, rRNA, snRNA etc, were taken in consideration.
Genome Build:
kumo-heterozygous-genome-mappers.txt: Dmel rel 5
|
| |
|
| Submission date |
Dec 27, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Toshie Kai |
| E-mail(s) |
toshie@tll.org.sg
|
| Organization name |
Temasek Life Sciences Laboratory
|
| Street address |
1 Research Link, National University of Singapore
|
| City |
Singapore |
| ZIP/Postal code |
117604 |
| Country |
Singapore |
| |
|
| Platform ID |
GPL11203 |
| Series (1) |
| GSE34728 |
The tudor domain protein Kumo is required to assemble the nuage and to generate germline piRNAs in Drosophila |
|
| Relations |
| SRA |
SRX113189 |
| BioSample |
SAMN00768925 |
