|
| Status |
Public on Feb 01, 2012 |
| Title |
+3 long day (LD) C |
| Sample type |
SRA |
| |
|
| Source name |
laser dissected shoot apical meristems
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
developmental stage: after 3 LD induction
strain: Col-0
tissue: shoot apical meristems
|
| Growth protocol |
short days condition (8 hours light, 16 hours darkness)
long days condition (16 hours light, 8 hours darkness)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA extraction, RNA amplification, cDNA synthesis with random primers.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
For replicate A and B: whole transcriptome shotgun; For replicate C: ready-to-run library
|
| Data processing |
Analysis of short-sequence reads from Illumina-Solexa sequencing
-Trimming and Filtering
The data were initially filtered using “Seqclean” (release dated 2005-08-18). This program trims matches against user-specified target sequences, which here were the primer sequences
(GACGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGG
and CCAGCATACAGATCTCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTC), as well as the UniVec_Core database (dated 2008-10-08), poly-A tails and ends rich in undetermined bases. After trimming, a read may be removed entirely for one of 3 reasons: (a) the sequence is shorter than the minimum length specified via the "-l" parameter (here, 30), (b) the percentage of undetermined bases is greater than 3%, and (c) less than 40nt of the sequence is left unmasked by the "dust" low-complexity filter.
-Mapping the reads
Each dataset of reads was converted into a blast database using “formatdb”. To identify matches to known genes, the TAIR8 cDNA collection (TAIR8_cdna_20080325) was then compared to the read databases using Megablast (settings: -v 2000 -b 500 -a 4 -W16 -p 0.6 -e 1 -D3).
The initial runs were performed using the Megablast version BLASTN 2.2.13 [Nov-27-2005]; the last runs were done with BLASTN 2.2.21 [Jun-14-2009].
-Determining raw expression counts of genes (loci)
The Megablast output was converted to an expression count by the following 4 steps, in this order:
(1) discard a match if its bitscore is 5 or more below the best bitscore that is reached by the respective read
(2) discard a match if it is shorter than 20 bp, or if its edit distance (number of gaps + number of mismatches) is 4 or more, or if the match does not start within the first 3 bases of the read (rationale for the last condition: sequencing quality is best at the 5' end, therefore a true match should cover the 5' end)
(3) discard all matches involving reads that map to more than a single locus (note that a locus can encompass more than a single transcript (cDNA))
(4) for each locus, count the number of different reads that map to it (a single read can map multiple times to a locus if the locus has multiple transcripts: yet, the read will be counted only once at this step)
The count of step (4) is output as a raw expression count.
-Identifying differentially expressed genes
The count data was normalized with edgeR and the package's exact test for the negative binomial distribution was used to compute p-values
|
| |
|
| Submission date |
Dec 15, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
George Coupland |
| E-mail(s) |
coupland@mpipz.mpg.de
|
| Phone |
+49 221 5062 205
|
| URL |
http://www.mpiz-koeln.mpg.de/english/research/couplandGroup/coupland/index.html
|
| Organization name |
Max Planck Institute for Plant Breeding Research
|
| Department |
Plant Developmental Biology
|
| Lab |
Coupland Lab
|
| Street address |
Carl-von-Linne-Weg 10
|
| City |
Köln |
| ZIP/Postal code |
50829 |
| Country |
Germany |
| |
|
| Platform ID |
GPL9302 |
| Series (1) |
| GSE34476 |
Analysis of the Arabidopsis shoot meristem transcriptome during floral transition identifies distinct regulatory patterns and an LRR protein that promotes flowering |
|
| Relations |
| SRA |
SRX111844 |
| BioSample |
SAMN00765695 |
