 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 11, 2024 |
| Title |
S5_KO_2 |
| Sample type |
SRA |
| |
|
| Source name |
H1
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: H1
cell type: ESC derived pancreatic cells
genotype: mutant
alleles: RFX6-/-
clone: 1H
protocol stage: stage5
developmental stage: Endocrine precursors
|
| Treatment protocol |
The hESCs H1 cell-lines were differentiated using the extended 7-stage protocol (stages 1–4 in adherent culture, stage 5 in AggreWell (Stemcell Technologies, #34421), and stages 6 and 7 in suspension culture).
|
| Growth protocol |
The RFX6 mutation was introduced into H1 hESCs using Ribonucleoprotein (RNP) CRISPR-Cpf1 system (Integrated DNA Technologies), with a guide and a mutation template that were designed with Benchling (Biology Software, 2017) (gRNA mutation: TTACACTTTTGGCAAGGAATG).
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA was extracted using NucleoSpin Plus RNA kit (Macherey-Nagel).
The library used NEBNext Ultra II Directional RNA kit.
Sequencing was performed using NovaSeq SP 2x100 bp v1.5 chemistry.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
27_1H_S5_4_S14
|
| Data processing |
The raw data was filtered with cutadapt (Martin, 2011) to remove adapter sequences, ambiquous (N) and low quality bases (Phred score < 25). We also excluded read pairs that were too short (<25bp) after trimming.
The filtered reads were mapped to the human reference genome (GRCh38) with STAR aligner (Dobin et al., 2013).
Gene expression was counted from read pairs mapping to exons using featureCounts in Rsubreads (Liao, Smyth and Shi, 2019). Duplicates, chimeric and multimapping reads were excluded, as well as reads with low mapping score (MAPQ < 10).
The read count data was analyzed with DESeq2 (Love, Huber and Anders, 2014). We analyzed the effect of RFX6 knockout separately for each developmental stage (stage3, stage5 and stage7).
Assembly: GRCh38
Supplementary files format and content: csv, DESeq2 results and read counts
|
| |
|
| Submission date |
Jun 06, 2023 |
| Last update date |
Apr 11, 2024 |
| Contact name |
Jouni Antero Kvist |
| Organization name |
University of Helsinki
|
| Department |
Research Program for Molecular Neurology
|
| Lab |
Medical Neurogenetics group
|
| Street address |
Haartmaninkatu 8
|
| City |
Helsinki |
| State/province |
Uusimaa |
| ZIP/Postal code |
00014 |
| Country |
Finland |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE234289 |
RFX6 haploinsufficiency predisposes to diabetes through impaired beta cell function |
|
| Relations |
| BioSample |
SAMN35652062 |
| SRA |
SRX20608004 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
