|
| Status |
Public on Dec 01, 2011 |
| Title |
WT(T+S)_sRNA |
| Sample type |
SRA |
| |
|
| Source name |
Mixed stage inflorescence tissue
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
genotype/variation: transgenic wild type plant (contains trigger and silencer transgenes)
ecotype: Columbia-0
tissue: Mixed stage floral inflorescences (inflorescence meristem and floral buds to stage 12)
|
| Growth protocol |
Seeds were germinated on soil and grown for approximately 5 weeks at 22-23°C under a light cycle of 8 hours dark, 16 hours light. Mixed stage floral inflorescences (inflorescence meristem and floral buds to stage 12) were harvested between 9 and 12 AM and stored in 50 ml Falcon tubes at -80°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from mixed stage inflorescence tissues of the transgenic wild type and the ago6-4 mutant using TRIzol reagent (Invitrogen). Total RNA (200 ug) for each sample was used to construct the small RNA libraries as described previously (Lu et al., 2007) but with different adapters. The RNA oligos (Dharmacon) used for small RNA ligations were as follows: 5' RNA Adapter (5'OH-GUUCAGAGUUCUACAGUCCGACGAUC-OH 3') and 3' RNA Adapter: (5'pUCGUAUGCCGUCUUCUGCUUGUidt 3'; p, phosphate; idT, inverted deoxythymidine). Libraries were sequenced on an Illumina GAII following the manufacturer's protocols at the Delaware Biotechnology Institute.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
sRNA library constructed from mixed stage inflorescence of Arabidopsis ago6-4/21.4y.The sRNA library was created using the protocol published by Cheng Lu in Methods
Processed data file: Text containing distinct smallRNAs with their raw abundance after removing the adapter sequences.
Processed data file name: SS_691_chopped.txt (represented in data table below).
|
| Data processing |
Library selection: PCR
Adapter sequences were removed using a Perl script, generating small RNA sequences plus abundances. The data were matched to the Arabidopsis genome (TAIR v9) as well as the transgenes described in Kanno et al. (2008). Of the 4,510,985 total reads from transgenic wild type and 2,327,100 from the ago6-4 mutant, 2,846,684 (wt) and 1,261,189 (ago6-4) reads matched the genome, excluding 362,400 (wt) and 207,909 (ago6-4) that matched tRNA, rRNA, snRNA or snoRNAs.
|
| |
|
| Submission date |
Apr 12, 2011 |
| Last update date |
Jun 11, 2013 |
| Contact name |
Blake C. Meyers |
| E-mail(s) |
bmeyers@danforthcenter.org
|
| Phone |
314-587-1422
|
| Organization name |
Donald Danforth Plant Science Center
|
| Lab |
Meyers lab
|
| Street address |
975 N Warson Road
|
| City |
St. Louis |
| State/province |
MO |
| ZIP/Postal code |
63132 |
| Country |
USA |
| |
|
| Platform ID |
GPL9302 |
| Series (1) |
| GSE28537 |
AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana |
|
| Relations |
| BioSample |
SAMN02198514 |
