 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 01, 2024 |
| Title |
HEK293CDK7as_MNaseChIPseq_TFIIB_DMSO_30min_Rep3 |
| Sample type |
SRA |
| |
|
| Source name |
genome edited HEK293
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: genome edited HEK293
cell type: Human embryonic kidney
genotype: analog-sensitive CDK7
treatment: 30 min DMSO
immunoprecipitation antibody: TFIIB (Santa Cruz, sc-271736)
method: MNase-ChIP-seq
|
| Treatment protocol |
Cells were treated for 15, 30, or 60 min with 7.5 μM of 1-NM-PP1 (Sigma-Aldrich, St. Louis, MO USA) or an equal DMSO (solvent control; Sigma-Aldrich, St. Louis, MO USA) volume.
|
| Growth protocol |
Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, 11960085) supplemented with 10% fetal bovine serum (Gibco, 10500–064) and 1 % GlutaMAX (Thermo Fisher Scientific, 35050087) in a humidified incubator at 37°C and 5% CO2. Cells were passaged every 2-3 days using 0.25% Trypsin-EDTA (Gibco, 25200056). Biological replicates were cultured separately. All cell lines were verified to be free of mycoplasma contamination with PlasmoTest Mycoplasma Detection Kit (InvivoGen). Drosophila Schneider-2 (S2) cells, used for MNase-ChIP-seq spike-ins, were obtained from DSMZ (ATCC Cat# CRL-1963, RRID: CVCL_Z232) and cultured in Schneider's Drosophila-Medium (Gibco, 21720024) supplemented with 10% fetal bovine serum (Gibco, 10500–064) in a non-humidified incubator at 27°C, protected from light. Yeast S. cerevisiae cells (BY4741 strain), used for mNET-seq spike-ins, were obtained from Euroscarf (ACC-Y00000) and cultured in yeast medium (YP + 2% glucose) at 30°C until OD595 of 0.8 was reached.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
TT-seq: Total RNA was extracted using TRIzol reagent (Invitrogen, 15596026), 4sU-labeled RNA was extracted according to Gressel at al., protocols.io, 2019.
mNET-seq: mNET-seq was performed as previously described (Caizzi et al. 2021; Gressel et al. 2017; Nojima et al. 2016; Schlackow et al. 2017) with minor changes. 50 mio CDK7as cells were treated for 15 or 30 min with 7.5 μM of 1-NM-PP1 or DMSO (solvent control). After the treatment, chromatin isolation was performed as described in the protocol for cellular fractionation (Conrad et al. 2017) using 25 mio cells per reaction. All buffers were supplemented with 7.5 μM 1-NM-PP1 or respective amounts of DMSO, protease (Sigma-Aldrich, P8340), and phosphatase (Roche, 4906837001) inhibitors. After the fractionation, the chromatin pellet was digested in 100 μl MNase digest buffer (1x MNase buffer, 1x BSA, 100 mM NaCl, 50 units/μl MNase (NEB, M0247S)) at 37°C and 1,400 rpm for 2 min. The digestion was stopped by adding 11 μl of 250 mM EGTA, and samples were centrifuged at 13,000 g for 5 min at 4°C. Supernatants were pooled together for each sample and 8-fold diluted with IP buffer (50 mM Tris HCl pH 7.4, 150 mM NaCl, 0.05% NP-40, 0.3% empigen (Sigma-Aldrich, 30326)). 15 μg of anti-Pol II CTD antibody (Diagenode, C15200004) conjugated with 125 μl of Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen, 11201D) were added to each sample and incubated on a rotating wheel at 4°C and 12 rpm for 1 h. After IP, beads were washed seven times with 1 ml of IP buffer and once with 300 μl of PNKT buffer (1x T4 PNK buffer (NEB, M0236L), 0.1% Tween-20). After washes, 5’ RNA ends were phosphorylated with T4 Polynucleotide Kinase (PNK) (3' phosphatase minus; NEB, M0236L) at 800 rpm for 10 min at 37°C. Next, beads were washed once with IP buffer, and 0.5 ml of TRIzol reagent (Invitrogen, 15596026) was added to the beads. 2.5 ng of S. cerevisiae spike-ins were added to each sample in TRIzol. RNA spike-ins for mNET-seq were obtained from S. cerevisiae cells as previously described (Caizzi et al. 2021). RNA was extracted from beads, followed by RNA precipitation with 100% ethanol and GlycoBlue coprecipitant (Invitrogen, AM9515) at -80°C overnight. RNA pellets were washed twice with 70% ethanol, air-dried, and dissolved in 7 M urea. In order to size select 25-110 nt RNA, samples were resolved on 6% polyacrylamide gel containing 7 M urea. RNA of corresponding sizes was extracted from the gel and precipitated with 100% ethanol and GlycoBlue coprecipitant.
MNase-seq: 5 mio CDK7as cells were treated for 15 min with 7.5 μM of 1-NM-PP1 or DMSO (solvent control) and centrifuged at 500 g for 3 min at 4°C. Cell pellets were resuspended in 50 μl of Buffer I (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 2.5 mM MgCl2, 0.5% NP-40, 10 % sucrose, 0.5 mM CaCl2) and incubated at 37°C for 2 min. Next, we added 500 μl of Buffer II (50 mM Tris-HCl pH 7.5, 50 mM NaCl, 2.5 mM MgCl2, 0.5% NP-40, 10 % sucrose, 2 mM CaCl2) supplemented with 3,000 U of MNase (NEB, M0247S) and incubated at 37°C for 9 min. MNase digestion was quenched with 11 μl of EGTA (500 mM). 550 μl of SDS Lysis Buffer (50 mM Tris-HCl pH 8.0, 1% SDS, 10 mM EDTA) was added, and samples were incubated on ice for 10 min. Samples were then treated with 0.1 μg/μl RNAse A (Thermo Scientific, EN0531) for 1.5 h at 37°C and 0.05 μg/μl Proteinase K (Life Technologies, AM2546) for 4 h at 65°C. DNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (Sigma-Aldrich, P2069), followed by DNA precipitation with an equal volume of 100% ethanol and 200 mM NaCl for 2 h at -20°C. DNA pellets were washed twice with 1 ml of 70% ethanol, air-dried, and dissolved in water.
MNase-ChIP-seq: MNase-ChIP-seq was performed as previously described (Skene et al. 2015) with the following changes. 40 mio CDK7as cells were treated for 30 min with 7.5 μM of 1-NM-PP1 or DMSO (solvent control), following 8 min crosslinking with 1% formaldehyde (16% formaldehyde (w/v), methanol-free, Thermo Fisher Scientific, 28908). The crosslinking was quenched for 5 min with 125 mM glycine, and cells were washed with 10 ml PBS at room temperature. 2 ml of ice-cold PBS was added to plates for cell scraping. Scraped cells were transferred to falcons, washed twice with 5 ml ice-cold PBS, and centrifuged at 200 g for 5 min at 4°C. All buffers were supplemented with protease (Sigma-Aldrich, P8340) and phosphatase (Roche, 4906837001) inhibitors. Cell pellets were lysed with 5 ml of Farnham Lysis buffer (5 mM Pipes pH 8, 85 mM KCl, 0.5% NP-40) for 10 min on ice. Nuclei were pelleted by centrifugation at 1,700 g for 5 min at 4°C and washed with ice-cold PBS. Nuclei pellets were resuspended in 200 μl of 1% SDS Lysis buffer (50 mM Tris HCl pH 8.0, 10 mM EDTA, 1% SDS) and incubated for 10 min at room temperature to permeabilize nuclei. The reaction was quenched with 1.8 ml of IP buffer (20 mM Tris HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100) supplemented with 5 mM CaCl2 and incubated for 2 min at 37°C before the addition of 16,000U of MNase (NEB, M0247S) for 20 min at 37°C. MNase digestion was quenched with 40 μl of EDTA (500 mM) and 20 μl EGTA (500 mM). 1 ml of sample was transferred to AFA milliTubes (Covaris, 520135) and sonicated with a Covaris S220 Focused-ultrasonicator with the following parameters: 5% duty cycle, 140 W peak incident power, 200 cycles per burst, 600 sec processing time, 6°C bath temperature, continuous degassing mode, water level 8. Sonicated samples were centrifuged at 10,000 g for 15 min at 4°C, and supernatants were snap-frozen in liquid nitrogen and stored at −80°C before use. For each IP, 30 μg of sample chromatin and 200 ng of Drosophila S2 MNase-digested crosslinked chromatin were diluted in IP buffer to obtain a final concentration of 0.05% SDS and a final volume of 1.6 ml. Pre-clearing was carried out by adding 20 μl of Dynabeads Protein G (Thermo Fisher Scientific, 10009D) diluted in IP buffer, and incubating for 30 min at 4°C on the rotation wheel. Pre-cleared samples were incubated with 10 μg of Pol II (RPB1, Diagenode, C15200004), 10 μg of Ser5P (phospho-CTD Ser-5 of RPB1, Merck Millipore, 04-1572), 8 μl of Mediator (MED26, Cell Signaling, 14950), 6 μg of TFIIB (Santa Cruz, sc-271736), 5 μg of TFIIE (TFIIE-α, abcam, ab28177), 6 μg of NELF (NELF-E, Bethyl Laboratories, A301-913A) or 6 μg of SPT5 (Proteintech, 16511-1-AP) together with 1 μg of Spike-in (Active Motif, 61686) antibodies at 4°C overnight. The next day samples were centrifuged at 16,000g for 2 min at 4°C and inputs were taken for each sample. Samples were incubated for 2 h at 4°C with Dynabeads Protein G. Beads were washed once with Buffer 1 (20 mM Tris HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), four times with Buffer 2 (20 mM Tris HCl pH 8.0, 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), once with Buffer 3 (10 mM Tris HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% sodium-deoxycholate), and three times with TE buffer (10 mM Tris HCl pH 8.0, 50 mM NaCl, 1 mM EDTA). After the last wash, 200 μl of elution buffer (0.1 M NaHCO3, 160 mM NaCl, 1% SDS) was added to the beads, and samples were de-crosslinked overnight at 65°C. Next, samples were diluted with 200 μl of PBS and treated with 0.02 μg/μl RNAse A (Thermo Scientific, EN0531) for 1.5 h at 37°C and 0.2 μg/μl Proteinase K (Life Technologies, AM2546) for 2 h at 45°C. DNA was extracted with an equal volume (400 μl) of phenol/chloroform/isoamyl alcohol (Sigma-Aldrich, P2069), followed by DNA precipitation with 100% ethanol and 200 mM NaCl for 1 h at -80°C. DNA pellets were washed twice with 70% ethanol, air-dried, and dissolved in water.
TT-seq: Libraries were prepared from 100 ng of RNA with the strand-specific Ovation Universal RNA-Seq library kit (NuGEN, 0343-32).
mNET-seq: 8.4 ng of RNA for replicate 1 and 12.3 ng of RNA for replicate 2 were used for library preparation with TruSeq Small RNA Library Prep Kit (RS-200-0048) according to the manufacturer’s instructions.
MNase-seq: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S) according to the manufacturer’s instructions.
MNase-ChiP-seq: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S) according to the manufacturer’s instructions with adjusted for short fragments end repair, 5’ phosphorylation, and dA-tailing thermocycler program (30 min at 20°C, 1 h at 50°C; the heated lit set to 60°C). After amplification, libraries were double-sided (1.0 – 1.6x) size-selected with Agencourt AMPure XP beads (Beckman Coulter, A63881).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
All sequencing data were demultiplexed with Illumina bcl2fastq demultiplexing software, provided the barcodes for each of the samples, and subsequently quality checked with FastQC (Babraham-Institute) (Andrews, 2010).
TT-seq: For all samples, paired-end 75 base reads were mapped using STAR (v 2.6.1b) (Dobin et al., 2013) to the GRCh38.p13 genome assembly merged with synthetic RNA spike-in sequences (Schwalb et al., 2016; Żylicz et al., 2019) with a maximum 2% mismatches [mapping parameters: --outFilterMismatchNoverLmax 0.02 --outFilterMultimapScoreRange 0 --alignIntronMax 500000]. SAMtools (v 1.3.1) (Li et al., 2009) was used to quality filter SAM files, whereby alignments with MAPQ smaller than 7 (-q 7) were skipped, and only proper pairs (-f2) were selected. A spike-in (RNA) normalization strategy was used essentially as described (Schwalb et al., 2016). This spike-in normalization allows for calculating sequencing depth σ_j, cross-contamination rate ϵ_j, and antisense bias ratio c_j. Sequencing depth σ_j allows to observe global shifts. The read counts (kij) for spike-ins were calculated using HTSeq (Anders et al., 2015).
mNET-seq: For all samples, paired-end 45 base reads were trimmed for adapters (-a TGGAATTCTCGGGTGCCAAGG -A GATCGTCGGACT), and low-quality bases (< Q20) were removed with Cutadapt (v 1.9.1) (Martin, 2011). The reads were then mapped to the GRCh38.p13 genome assembly merged with the yeast genome version SacCer3 using STAR (v 2.5.2b) (Dobin et al., 2013) with a maximum of 2% mismatches [mapping parameters: --outFilterMultimapScoreRange 0 --outFilterMismatchNoverLmax 0.02 --outFilterMatchNmin 16 --outFilterScoreMinOverLread 0 --outFilterMatchNminOverLread 0 --alignIntronMax 500000 ]. Samtools (v 1.3.1) (Li et al., 2009) was used to quality filter SAM files, where alignments with MAPQ smaller than 7 (-q 7) were skipped, and only proper pairs (-f 2) were selected. Read counts (kij) for yeast genes for each condition j (control or CDK7as inhibited) were calculated using HTSeq (Anders et al., 2015). The counts data was used to generate normalization factors with DESeq2 (Love et al., 2014) to normalize the mNET-seq data.
MNase-seq: For all samples, paired-end 45 base reads were trimmed for low-quality bases, random matches, and for a minimum length [trimming parameters: -q 20,20 -O 12 -m 25] with Cutadapt (v 1.9.1) (Martin, 2011). Processed reads were then mapped to the GRCh38.p13 genome assembly using STAR (v 2.6.1b) (Dobin et al., 2013) with maximum 2 percent mismatches [mapping parameters: --outFilterMismatchNoverLmax 0.02 --outFilterMultimapScoreRange 0 --alignIntronMax 1]. Samtools (v 1.3.1) (Li et al., 2009) was used to quality filter SAM files, where alignments with MAPQ smaller than 7 (-q 7) were skipped, and only proper pairs (-f 2) were selected.
MNase-ChIP-seq: For all samples, paired-end 43 base reads were mapped using Bowtie 2 (v 2.3.4.1) (Langmead and Salzberg, 2012) to the merged human hg38 (GRCh38.p13) and Drosophila (BDGP6.28) genome assembly [mapping parameters: --no-discordant --no-mixed --very-sensitive]. SAMtools (v 1.3.1) (Li et al., 2009) was used to quality filter SAM files, whereby alignments with MAPQ smaller than 7 (-q 7) were skipped, and only proper pairs (-f2) were selected. Further data processing was carried out using the R/Bioconductor environment. Duplicate fragments and fragments longer than 100 bp (70 bp for Pol II) were excluded from further analysis. MNase-ChIP-seq coverages were obtained from piled-up fragment midpoint counts for every genomic position. Pol II, Ser5P, and SPT5 coverages were normalized to the signal at untranscribed regions to allow for the detection of global changes. To this end, genome-wide coverage was calculated from all MNase-ChIP-seq fragment midpoints in consecutive 2 kbp bins throughout the non-transcribed human genome (i.e. excluding 32,789 transcribed units we annotated using GenoSTAN (Zacher et al., 2017) and everything annotated in GENCODE v31) and used to generate normalization factors with DESeq2 (Love et al., 2014). For all other factors, which exhibited a peak-like binding behavior, normalization factors were obtained from total human fragment counts. Bigwig files are for normalized (except Inputs), entire fragment coverages.
Assembly: GRCh38
Supplementary files format and content: bigwig files
|
| |
|
| Submission date |
Nov 17, 2022 |
| Last update date |
Jun 01, 2024 |
| Contact name |
Michael Lidschreiber |
| E-mail(s) |
michael.lidschreiber@mpinat.mpg.de
|
| Organization name |
Max-Planck-Institute for Multidisciplinary Scienes
|
| Street address |
Am Fassberg 11
|
| City |
Goettingen |
| ZIP/Postal code |
37077 |
| Country |
Germany |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE218269 |
CDK7 kinase activity promotes RNA polymerase II promoter escape by facilitating initiation factor release |
|
| Relations |
| BioSample |
SAMN31776841 |
| SRA |
SRX18300384 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6738217_HEK293CDK7as_MNaseChIPseq_TFIIB_DMSO_30min_Rep3.fragment.smaller100bp.norm.coverage.bw |
127.9 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
