|
| Status |
Public on Jun 02, 2011 |
| Title |
A549 MALAT-1 knockdown replication 2-1 |
| Sample type |
RNA |
| |
|
| Channel 1 |
| Source name |
A549 MALAT-1 knockdown
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549
|
| Treatment protocol |
To carry out RNA interference, siRNA duplexes, synthesized by Invitrogen (stealth MALAT483:CACAGGGAAAGCGAGTGGTTGGTAA) were transfected into cells using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's guidelines
|
| Growth protocol |
Cells were grown at 37°C, 5% CO2 in Dulbecco’s Modified Eagle's Medium supplemented with 10% fetal calf serum and penicillin/streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
separation: scrapping from surface
extraction source: frozen
extraction source: pooled cells
kit: Invitrogen Trizol reagent
|
| Label |
Cy3
|
| Label protocol |
Kit: Low RNA Input Linear Amplification kit
Manufacturer: Agilent Technologies
Manual: Low RNA Input Linear Amplification kit standard protocol
|
| |
|
| Channel 2 |
| Source name |
A549 Control
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549
|
| Treatment protocol |
control
|
| Growth protocol |
Cells were grown at 37°C, 5% CO2 in Dulbecco’s Modified Eagle's Medium supplemented with 10% fetal calf serum and penicillin/streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
separation: scrapping from surface
extraction source: frozen
extraction source: pooled cells
kit: Invitrogen Trizol reagent
|
| Label |
Cy5
|
| Label protocol |
Kit: Low RNA Input Linear Amplification kit
Manufacturer: Agilent Technologies
Manual: Low RNA Input Linear Amplification kit standard protocol
|
| |
|
| |
| Hybridization protocol |
hybridization_Kit: in situ hybridization plus
hybridization_Manufacturer: Agilent Technologies
hybridization_Manual: Agilent Technologies
|
| Scan protocol |
Scanner: Agilent DNA microarray Scaner
Manufacturer: Agilent Technologies
Software: Scanner Control software
Manufacturer: Agilent Technologies
Manual: Agilent Technologies
|
| Description |
Mammalian non-coding transcript
|
| Data processing |
Software: Feature Extraction ver 9.5
Manufacturer: Agilent Technologies
Manual: Agilent Technologies
|
| |
|
| Submission date |
Jun 01, 2010 |
| Last update date |
Jun 02, 2011 |
| Contact name |
RANDEEP RAKWAL |
| E-mail(s) |
plantproteomics@gmail.com
|
| Phone |
+81-(0)90-1853-7875
|
| Organization name |
University of Tsukuba
|
| Department |
Institute of Health and Sport Sciences
|
| Lab |
Global Sport Innovation (GSI) 403
|
| Street address |
1-1-1 Tennodai
|
| City |
Tsukuba |
| State/province |
Ibaraki |
| ZIP/Postal code |
305-8574 |
| Country |
Japan |
| |
|
| Platform ID |
GPL4133 |
| Series (1) |
| GSE22085 |
The MALAT-1 noncoding RNA Regulates Cell Mobility by Modulating Gene Expressions |
|
