|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 07, 2021 |
Title |
RNAseq.mouse.testis.CBP80IP.adult |
Sample type |
SRA |
|
|
Source name |
mouse.testis.CBP80IP.adult
|
Organism |
Mus musculus |
Characteristics |
strain: C57B6 genotype: wt age: adult tissue: whole testis molecule subtype: rRNA depleted RNA
|
Treatment protocol |
The mice were anesthetized with Ketamine/Xylazine mixture (Ketamine 100 mg/kg; Xylazine 25 mg/kg) via intraperitoneal injection. After complete anesthesia, testes were exteriorized with a longitudinal incision around 1 cm at the center of abdomen. The tunica albuginea was penetrated using a sharp 26 G needle (BD, Franklin Lakes, NJ, USA, 30511) 1 mm from the vascular pedicle, and the needle was withdrawn to generate path for introducing a blunt end Hamilton needle (Hamilton, Reno, NV, USA, 7786-02). PBS containing 0.02% Fast Green FCF (Thermo Fisher Scientific, Waltham, MA, USA) with harringtonine (LKT labs, 0.5 μg/μl in a total volume of 10 μl) or puromycin dihydrochloride (Invitrogen, 2.5 μg/μl in a total volume of 10 μl) was slowly injected using a Hamilton microsyringe (1705RN) into one testis, and vehicle control without drug was injected into the other testis. The needle was held in place for 30 seconds before removal to prevent back flow of the solution. Successful completion of injection was indicated by testis filled with green solution. The testes were returned to the abdominal cavity after injection. The incisions were sutured. At the end point, the mice were euthanized by cervical dislocation, and the testes were collected.
|
Growth protocol |
Animals mice were maintained and used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester. Lizards were used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNAs were extracted using mirVana miRNA Isolation Kit (ThermoFisher, AM1560), and rRNAs were depleted from total RNAs with complementary DNA oligomers (IDT) and RNaseH (Invitrogen, Waltham, MA, USA) 1, Strand-specific RNA-seq: libraries were constructed following the TruSeq RNA sample preparation protocol. 2, Ribo-seq: Testes samples were lysed, RNase T1 & A treated and loaded on sucrose gradients, and 80S monosomes were recovered for library constrution. The 3'-adapter is TGGAATTCTCGGGTGCCAAGG and has been trimmed in the raw data.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
Strand-specific RNA-seq
|
Data processing |
Analyses were performed using piPipes v1.4. All data from the ribosome profiling (Ribo-seq), RNA sequencing, were analyzed using the latest mouse genome release mm10 (GCA_000001635.7). Generally, one mismatch is allowed for genome mapping. For RNA-seq reads, the expression per transcript was normalized to the top quartile of expressed transcripts per library calculated by Cuffdiff, and the tpm (transcripts per million) value was quantified using the Salmon software. For Ribo-seq analysis, uniquely mapping reads between 26 nt and 32 nt were selected for further analysis. Libraries from harringtonine treatment were further normalized to the sum of reads mapping to mitochondrial coding sequences. Libraries from puromycin treatment were further normalized to the sum of reads mapping to the 5´-UTR of mRNAs. Genome_build: Mouse: mm10 (GCA_000001635.7) Supplementary_files_format_and_content: For Ribo-seq, processed data files are unique genome alignment results in BED13 format (https://github.com/bowhan/piPipes/wiki). RNAseq quantification results are .sf files output by Salmon software.
|
|
|
Submission date |
Jul 29, 2020 |
Last update date |
Sep 07, 2021 |
Contact name |
Xin Li |
E-mail(s) |
Xin_Li@urmc.rochester.edu
|
Phone |
(585) 275-6576
|
Organization name |
University of Rochester
|
Department |
Biochemistry and Biophysics
|
Lab |
Li Lab
|
Street address |
601 Elmwood Ave
|
City |
Rochester |
State/province |
NY |
ZIP/Postal code |
14623 |
Country |
USA |
|
|
Platform ID |
GPL13112 |
Series (1) |
GSE155350 |
Coupled protein synthesis and ribosome-guided piRNA processing on mRNAs |
|
Relations |
BioSample |
SAMN15667086 |
SRA |
SRX8843449 |
Supplementary file |
Size |
Download |
File type/resource |
GSM4699677_RNAseq.mouse.testis.CBP80IP.adult.quant.sf.txt.gz |
769.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|