GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4275010

Query DataSets for GSM4275010

Status

Public on Dec 16, 2021

Title

1-2h M-,Z+ mettl3 and mettl14 double mutant embryos RNA-seq replicate 1

Sample type

SRA

Source name

w1118 embryo M-,Z+ mettl3 and mettl14 double mutant

Organism

Drosophila melanogaster

Characteristics

background strain: w1118
genotype: w1118, M-,Z+ mettl3 and mettl14 double mutant
tissue: embryo
age: 1-2h

Extracted molecule

polyA RNA

Extraction protocol

Total RNAs were isolated from embryos at the indicated stages using TRIzol reagent (Thermo Fisher). The mRNAs were purified using a NEBNext Poly(A) mRNA Magnetic Isolation kit (NEB) according to the user manual. The MeRIP-Seq was performed by Cloudseq Biotech Inc. (Shanghai, China) . Briefly, 5 ug of fragmented mRNAs were incubated with 5 ug of anti m6A polyclonal antibody (millipore) in IP buffer (150 mM NaCl, 10 mM Tris–HCl, 0.1% NP-40, pH 7.4) for 2 h at 4°C. The mixture was then immunoprecipitated by incubation with protein-A beads (Thermo Fisher) at 4◦C for an additional 2 h. Beads with captured RNA fragments were then immediately washed 3 times with 500 μl of ice-cold IP buffer. Bound mRNAs were eluted from the beads with N6-methyladenosine (BERRY & ASSOCIATES, PR3732) in IP buffer and then extracted with Trizol reagent (Thermo Fisher).
To RNA-seq and RIP-seq, Illumina Truseq libraries were constructed according to the manufacturer’s instructions and sequenced using NovaSeq platform. with paired end read length of 150 bp. RNA-seq library generation with NEBNext® Ultra II Directional RNA Library Prep Kit (New England Biolabs, Inc., USA). MeRIP-Seq Library sequencing was performed on an illumina Hiseq instrument with 150bp paired-end reads.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Description

1-2h_M-,Z+_mettl3_and_mettl14_double_mutant_embryos_FPKM.txt

Data processing

For RNA-seq amd Fmr1 RIP-seq, the reads were mapped to the reference genome of Drosophila melanogaster (Release 6/dm6) with TopHat version 2.0.Differential expression analysis was carried out by cuffdiff.
For MeRIP (m6A)-seq, reads were processed using Cutadapt software with the parameter "cutadapt -m 20 -q 15 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCA -U 3", then the clean reads were aligned to the Drosophila genome (version dm6) using HISAT2. MACS2 software was used for m6A peak calling with the default options except for "-no modle".
Genome_build: dm6
Supplementary_files_format_and_content: bed file of the callpeak result. Txt files for the FPKM value of RNA-seq and FMR1 RIP-seq

Submission date

Jan 16, 2020

Last update date

Dec 16, 2021

Contact name

Guoqiang Zhang

E-mail(s)

gqzhang@ynu.edu.cn

Organization name

INSTITUTE OF ZOOLOGY, CHINESE ACADEMY OF SCIENCES

Street address

1 Beichen West Road, Chaoyang District