|
Status |
Public on May 08, 2020 |
Title |
PCF cells, 4d_3 |
Sample type |
SRA |
|
|
Source name |
whole animals
|
Organism |
Trypanosoma brucei |
Characteristics |
cell type: PCF cells genotype: RBP6OE timepoint: 4_days treatment: 4 days after induction of ectopically expressed RBP6 protein replicate: 3
|
Treatment protocol |
The induction of ectopically expressed RBP6 protein was triggered by the addition of 10 μg/ml of tetracycline into the media.
|
Growth protocol |
T. brucei PCF cells strains 29.13, transgenic for T7 RNA polymerase and the tetracycline repressor, were grown in vitro at 27°C in SDM-80 media containing hemin (7.5 mg/ml) and 10% FBS. The pLew100v5 vector for RBP6 expression was linearized with NotI enzyme and transfected into the cell line as described previously (Wirtz, 1999). RBP6OE cells were grown in SDM-80 medium containing no glucose, further supplemented with 50 mM N-acetyl glucose amine to block uptake of residual glucose molecules from 10% FBS.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated from T. brucei at different stages (1 × 10e8 cells/replicate) using the miRNeasy Kit (Qiagen) according to the manufacturer's protocol. An additional DNase1 digestion step was performed to ensure that the samples were not contaminated with genomic DNA. NGS library prep was performed with TruSeq Strand-Specific mRNA Library Prep with PolyA Selection following Illumina standard protocol. Libraries were sequenced on an Illumina NextSeq 500. The RNA-Seq measurement yielded on average 11.1 M single reads of 75 nt per sample.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Spliced-leader sequences (CAATATAGTACAGAAACTGTTCTAATAATAGCGTTAGTT) were removed from the reads using cutadapt (DOI:10.14806/ej.17.1.200) Single reads were mapped to the T. brucei 11 megabase chromosomes (TriTrypDB version 36) using STAR version 2.5.2b (https://doi.org/10.1093/bioinformatics/bts635), allowing up to 2 mismatches, a minimum intron length of 21 and keeping only uniquely aligned reads (on average 75.1 % of all reads). No. of reads per gene were counted using featureCounts (https://doi.org/10.1093/bioinformatics/btt656) from the subread package version 1.5.1 with default parameters and using the gene models provided by TriTrypDB version 36. For the differential expression analysis, we used R version 3.4.3 (http://www.R-project.org/) and DESeq2 version 1.18.1 (https://doi.org/10.1186/s13059-014- 525 0550-8) to normalize, transform, and model the data. The counts were fitted to a Negative Binomial generalized linear model (GLM) and the Wald significance test was used to determine the differentially expressed genes between control and knockdown samples. Genome_build: T. brucei TriTrypDB version 36 Supplementary_files_format_and_content: .txt raw count per gene files
|
|
|
Submission date |
Nov 21, 2019 |
Last update date |
May 08, 2020 |
Contact name |
Falk Butter |
E-mail(s) |
f.butter@imb-mainz.de
|
Organization name |
Institute of Molecular Biology gGmbH
|
Department |
Quantitative Proteomics
|
Lab |
Falk Butter
|
Street address |
Ackermannweg 4
|
City |
Mainz |
State/province |
Germany |
ZIP/Postal code |
55128 |
Country |
Germany |
|
|
Platform ID |
GPL20572 |
Series (1) |
GSE140796 |
Transcriptomics profiling of the developmental progression of Trypanosoma brucei |
|
Relations |
BioSample |
SAMN13344052 |
SRA |
SRX7198427 |