 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 24, 2020 |
| Title |
Bmem 3 Sp E 1 |
| Sample type |
SRA |
| |
|
| Source name |
CD19+CD38+CD138-CD11c-GL7-IgM-IgD- spleen
|
| Organism |
Mus musculus |
| Characteristics |
tissue: spleen
mouseid: 3
cellular_replicate: spleen_A
|
| Treatment protocol |
3x NP-CGG immunized C57BL/6 mice
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells from BM (tibiae, femurae and pelvic bones) and spleen of three times NP-CGG immunized-mice were isolated and Bsm were magnetically enriched using a “Memory B cell Isolation Kit” (130-095-838 Miltenyi). Bsm were further enriched by FACSorting of CD19+CD38+CD138-CD11c-GL7-IgM-IgD-small lymphocytes. Sorted cells of Mouse 1 and 2 were split into two equal aliquots (samples A, B) for BM and spleen samples as cellular (biological) replicates. Sorted cells of Mouse 3 were split into 4 samples (A, B, C, D). Biological replicates were processed independently from this point on. Cell samples were lysed in RNA lysis buffer (R1060-1-50, Zymo Research) and stored at -80°C. Total RNA was extracted from samples using the ZR RNA Miniprep Kit (Zymo Research) according to the manufacturer’s protocol (Catalog nos. R1064 & R1065). Isolated RNA was split and library preparation was performed in technical duplicates.
First-strand cDNA was synthesized with SMARTScribe Reverse Transcriptase (Clontech) using total RNA, a cDNA synthesis primer mix (mIgG12ab_r1(KKACAGTCACTGAGCTGCT), mIgG3_r (GTACAGTCACCAAGCTGCT), mIgA_r (CCAGGTCACATTCATCGTG) by metabion international AG) and a 5’ – template-switch adaptor with unique molecular identifiers (UMI) (SmartNNNa (AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)4)) according to the protocol “high-quality full length immunoglobulin profiling with unique molecular barcoding” by the Chudakov lab46. cDNA was purified with MinElute PCR purification Kit (Qiagen) and eluted in 10 µL 70°C nuclease-free H2O (Qiagen). The first PCR was performed according to the protocol of the Chudakov lab 46 using a Step-out primer M1SS (AAGCAGTGGTATCAACGCA) (annealing on the switch adaptor) and a mouse IgH reverse primer mix (mIgG12_r2 (ATTGGGCAGC CCTGATTAGTGGATAGACMGATG), mIgG3_r2 (ATTGGGCAGCCCTGATTAAGGGATAGA CAGATG), mIgA_r2 (ATTGGGCAGCCCTGATTTCAGTGGGTAGATGGTG) binding to the constant region of certain Ig heavy chains). The first PCR was performed with Q5 Hot Start High-Fidelity DNA polymerase (NEB) in a 50µL reaction volume using 7.5 µL of cDNA product with following PCR parameters: 1 cycle of 95°C for 1 min 30 sec; 20 cycles of 95°C for 10 sec, 60°C for 20 sec, 72°C for 40 sec; 1 cycle of 72°C for 4 min; storage at 4°C. PCR 1 products were purified with MinElute PCR purification Kit (Qiagen) and eluted in 25 µL 70°C nuclease-free H2O (Qiagen). Within the second PCR amplification46 a M1S primer ((N)4–6(XXXXX)CAGTGGTATCAACGCAGAG) (annealing on M1SS) and a step-out primer Z ((N)4-6(XXXXX)ATTGGGCAGCCCTGATT), both with sample barcodes, were used. PCR 2 was performed with Q5 Hot Start High-Fidelity DNA polymerase (NEB) in a 50µL reaction volume using 2 µL of PCR 1 product with following PCR parameters: 1 cycle of 95°C for 1 min 30 sec; 14-15 cycles of 95°C for 10 sec, 60°C for 20 sec, 72°C for 40 sec; 1 cycle of 72°C for 4 min; storage at 4°C. PCR 2 products were purified with MinElute PCR purification Kit (Qiagen) and eluted in 25 µL 70°C nuclease-free H2O (Qiagen). The products were also gel-purified from 2% agarose gels (extraction with MinElute gel extraction Kit (Qiagen); elution in 15 µL 70°C nuclease-free H2O (Qiagen). Adapter ligation was performed using the TruSeq® DNA PCR-Free Library Prep protocol (Illumina). The products were gel-purified from 2% agarose gels instead of bead purification as mentioned in the protocol (extraction with MinElute gel extraction Kit (Qiagen); elution in 10 µL 70°C nuclease-free H2O (Qiagen)). The quality of amplified libraries was verified using an Agilent 2100 Bioanalyzer (2100 expert High Sensitivity DNA Assay). According to the fragment size, the libraries were quantified by qPCR using the KAPA Library Quantification Kit for Illumina platforms (KAPA Biosystems).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Samples were demultiplexed by MIGEC-1.2.4a using checkout and '-cute' as settings.
Different Ig-isotypes were further demultiplexed according to the presents of the IgG1/2, IgG3 and IgA specific primer sequence: AGTGGATAGACMGATG, AAGGGATAGACAGATG and TCAGTGGGTAGATGGTG allowing one mismatch.
Each isotype and sample were further analysed by MIGEC using UMI-guided correction in default parameter settings and segment file, adjusted to include only C57BL/6-specific V genes for mapping.
Genome_build: mm10
Supplementary_files_format_and_content: tsv: tab-seperated values including clonal counts, fractions, the VDJ-Gene annotation and the nucleotide and aminoacid sequence of the CDR3 region for each sample and isotype.
|
| |
|
| Submission date |
Nov 01, 2019 |
| Last update date |
Apr 25, 2020 |
| Contact name |
Pawel Durek |
| E-mail(s) |
pawel.durek@drfz.de
|
| Organization name |
Deutsches Rheuma-Forschungszentrum
|
| Street address |
Charitéplatz 1
|
| City |
Berlin |
| ZIP/Postal code |
10117 |
| Country |
Germany |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE139835 |
Ig repertoire of IgG+ murine memory B cells |
| GSE140133 |
Single-Cell transcriptomes and BCR sequences of IgG+ murine memory B cells from Bone Marrow and Spleen |
|
| Relations |
| BioSample |
SAMN13178808 |
| SRA |
SRX7087172 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4147185_S57.IgA.tsv.gz |
12.4 Kb |
(ftp)(http) |
TSV |
| GSM4147185_S57.IgG12.tsv.gz |
18.3 Kb |
(ftp)(http) |
TSV |
| GSM4147185_S57.IgG3.tsv.gz |
17.2 Kb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
