|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jun 04, 2020 |
Title |
GeCKO-Nanog_SORT_T2 |
Sample type |
SRA |
|
|
Source name |
CRISPR-library-introduced Nanog-GFP/iRFP KI mESC line derived from C57BL6/J mESC
|
Organism |
Mus musculus |
Characteristics |
cell type: Embryonic stem cell treatment: Sorted_technical_rep2
|
Treatment protocol |
Nanog, Trim28, Dnmt3L knockin cells were transduced with the Mouse CRISPR Knockout Pooled Library (GeCKO v2) (Addgene, # 1000000052) (Sanjana et al., 2014) via spinfection as previously described. We used only Mouse library A gRNA. Briefly, 3x10^6 cells per well (a total of 1.2 x 10^7 cells) were plated into a LN511-coated 12 well plate in the standard media supplemented with 8 µg/ml polybrene (Sigma-Aldrich). Each well received a virus amount equal to MOI = 0.3. The 12-well plate was centrifuged at 1,000 g for 2 h at 37°C. After the spin, media was aspirated and fresh media (without polybrene) was added. Cells were incubated overnight. 24 h after spinfection, cells were detached with trypsin and were replated into 4 of LN511-coated 10 cm dishes with 0.5 µg/mL puromycin for 3 days. Media was refreshed daily. At 6 days after transduction, cells were treated with 25 µM BV. After 24 h, at least 1.75 × 10^5 cells showing GFP/iRFP expression ratio close to 1 were sorted by FACS, and plated on 12 well plates (LM 511/Std condition). Unsorted cells were passaged to 10 cm plates, 5 × 10^5 each. After expansion of these sorted cells for 1 week, cells with GFP/iRFP expression ratio were close to 1 were sorted again. These sorting and expansion procedures were repeated 4 times in total.
|
Growth protocol |
We knocked in GFP and iRFP reporter separately into the two alleles for Nanog, Trim28 and Dnmt3L genes using WT mESC line (Bruce 4 C57BL/6J, male, EMD Millipore, Billerica, MA). Knockin mESC lines were cultured on Laminin-511 coated dish under Std medium (StemSure D-MEM [Wako Pure Chemicals, Osaka, Japan], 15% of fetal bovine serum, 0.1 mM β-mercaptoethanol, 1x MEM nonessential amino acids [Wako Pure Chemicals], a 2 mM L-alanyl-L-glutamine solution [Wako Pure Chemicals], 1000 U/mL LIF [Wako Pure Chemicals], 20 mg/ mL gentamicin [Wako Pure Chemicals]).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
After 3 days after the fourth sorting, 2 x 10^5 cells were collected and genomic DNA was extracted using Wizard Genomic DNA Purification kit (Promega). PCR of the virally integrated guides was performed on sgDNA at the equivalent of approximately 2000 cells per guide in 48 parallel reactions using KOD-FX neo (TOYOBO, Japan) in a single-step reaction of 22 cycles. Primers are listed here: forward primer, AATGATACGGCGACCACCGAGATCTACACTCTTTC CCTACACGACGCTCTTCCGATCTNNNNNNNN(1–8-bp stagger) GTGGAAAGGACGAAACACCG; reverse primer, CAAGCAGAAGACGGCATACGAGATNNNNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGTGGGCGATGTGCGCTCTG, 8-bp index read barcode indicated in italic. PCR products from all 48 reactions were pooled, purified using PCR purification kit (Qiagen, Hilden, Germany) and gel extracted using the Gel extraction kit (Qiagen, Hilden, Germany). Resulting libraries were deep-sequenced on Illumina HiSeq platform with a total coverage of >8 million reads passing filter per library.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Cutadapt software (Martin, 2011) was used to trim adapter with the parameters “-g CGAAACACCG.” MAGeCK (v0.5.5) (Li et al., 2014) count command was executed with the parameters “count -l FASTA_GeckoV2_Mouse_A.csv --trim-5 0 --norm-method total --control-sgrna FASTA_GeckoV2_Mouse_A_controlList.txt.” Genome_build: FASTA_GeckoV2_Mouse_A.csv Supplementary_files_format_and_content: FASTA_GeckoV2_Mouse_A.csv is a reference file used for alignment.; FASTA_GeckoV2_Mouse_A_controlList.txt containing a list of control sgRNAs is used in MAGeCK analysis.; gecko_low.count.txt is resulting count data.
|
|
|
Submission date |
Jun 12, 2019 |
Last update date |
Jun 04, 2020 |
Contact name |
Itoshi NIKAIDO |
E-mail(s) |
itoshi.nikaido@riken.jp
|
Organization name |
RIKEN
|
Department |
Center for Biosystems Dynamics Research
|
Lab |
Laboratory for Bioinformatics Research
|
Street address |
2-1 Hirosawa
|
City |
Wako |
State/province |
Saitama |
ZIP/Postal code |
351-0198 |
Country |
Japan |
|
|
Platform ID |
GPL17021 |
Series (2) |
GSE132590 |
Genome-wide CRISPR library screening to identify genes involved in the regulation of the kinetic properties of transcriptional bursting |
GSE132593 |
Genome-wide kinetic properties of transcriptional bursting in mouse embryonic stem cells |
|
Relations |
BioSample |
SAMN12037602 |
SRA |
SRX6047916 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|