|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Dec 10, 2019 |
Title |
WT_CRISPR_line2_F12_sRNA-seq |
Sample type |
SRA |
|
|
Source name |
nematodes
|
Organism |
Caenorhabditis elegans |
Characteristics |
genotype: WT derived from CRISPR-cas9 piwi mutant line 2 tissue: whole worm developmental stage: young adult, 48 hours post hatching treatment: none
|
Treatment protocol |
RNAi treatment was performed using worms grown on 15 cm Petri dishes seeded with concentrated RNAi food. The Arhinger RNAi library was used to pick the selected bacteria clones.
|
Growth protocol |
Strains were maintained at 20°C, using standard methods (Brenner, 1974). Bristol N2 was the wild-type strain used.
|
Extracted molecule |
total RNA |
Extraction protocol |
Synchronous populations of worms were grown at 20°C on NGM plates seeded with OP50 E. coli concentrated food at a density of maximum 40,000 animals per 15 cm Petri dish and harvested at Young Adult stage at 48 hours post hatching. The harvested animals were washed three times with M9 buffer and 40 µl of worm pellet was frozen in dry ice with TRI Reagent (MRC, Inc.). After five repetitions of freeze and thaw, total RNA was isolated according to the TRI Reagent protocol. Ten micrograms of RNA were treated with 2 U of Turbo DNase (Ambion) at 37°C for 30 minutes followed by phenol-extraction and isopropanol precipitation. Agilent 2200 TapeStation System was used to evaluate the RIN indexes of all the RNA preps, and only samples with RIN > 8 was used for downstream applications. 10 µg of total DNase treated RNAs with RIN > 8 was size seleceted from 15% UREA PAGE gel and used to generate small RNA libraries. The library preparation was performed as essentially described by Jayaprakash et al., 2011, except that a 5’ polyphosphatase (lucigen RP8092H) treatment was performed to be able to clone tri-phosphate small RNAs, and that the PAGE gel extraction after each ligation was substitute with purification by 1.8 volumes of Agencourt RNAClean XP Beads (Beckman Coulter, NC0068576) and 3 volumes of isopropanol. The multiplexed amplified libraries were further purified using PippinPrep DNA size selection with 3% gel cassettes and the following parameters for the selection: BP start (115) and the BP end (165). The purified libraries were quantified using Qubit Fluorometer High Sensitivity dsDNA assay kit (ThermoFisher, Q32851) and sequenced either on NextSeq-500 Illumina platform using the NextSeq 500/550 High Output v2 kit 75 cycles (FC-404-2005) or Illumina MiniSeq platform using MiniSeq High Output Reagent Kit 75-cycles (FC-420-1001).
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
total sRNA
|
Data processing |
The 3' adaptor (TGGAATTCTCGGGTGCCAAGG) was trimmed from the raw reads using cutadapt (version 1.15) The trimmed reads were sorted by sequence using fastq-sort (from fastq-tools version 0.8) with option -s and deduplicated using a custom haskell program, keeping the highest quality among duplicates, at any given position The 5' and 3' 4 nt UMIs were removed from the deduplicated reads using cutadapt (version 1.15) with options -u 4 and -u -4 After removing UMIs, the reads from 18 to 24 nt were selected using bioawk version 20110810 The size-selected reads were mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.1) with options -L 6 -i S,1,0.8 -N 0 The reads that failed to map were inspected using grep -E -B 1 -A 2 "^G[ACGTN]{20,25}T+$" to detect possible reads starting with G with 20 to 25 nt followed by a poly-U tail that might have prevented the mapping, and this tail was removed from such reads using a custom haskell program before re-mapping them. Mapped and remapped reads were used to estimate the abundance of small RNAs derived from structural RNAs using featureCounts (version 1.5.2) with options -O -s 1 --fracOverlap 1 and annotations corresponding to tRNA, snRNA, snoRNA, rRNA or RNA (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz) The abundance of non-structural RNAs was estimated by subtracting the above counts from the number of mapped and remapped reads. Initially mapped reads were classified using a custom python program according to their length, composition and on the annotations on which they mapped. Reads that didn't match miRNA and piRNA annotations were considered as potential endo-siRNAs. The potential endo-siRNAs of size 21 to 23 nt that started with G were classified as “si_22G” if they mapped antisense to annotation belonging to the following categories: DNA transposons, RNA transposons, satellites, simple repeats (as annotated in http://hgdownload.cse.ucsc.edu/goldenPath/ce11/database/rmsk.txt.gz) or pseudogene or protein-coding genes (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz) The “si_22G” reads were re-mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.1) with options -L 6 -i S,1,0.8 -N 0 The resulting alignment was used to generate the normalized bigwig file using millions of non-structural RNAs as normalizer. This was done with a custom bash script using bedtools (version 2.27.1), bedops (version 2.4.26) and bedGraphToBigWig (version 4) Genome_build: C. elegans ce11 (WBcel235) Supplementary_files_format_and_content: bigwig files allowing to display the normalized abundance of “si_22G” RNAs along the genome
|
|
|
Submission date |
Jan 24, 2019 |
Last update date |
Dec 10, 2019 |
Contact name |
Germano Cecere |
E-mail(s) |
germano.cecere@pasteur.fr
|
Phone |
0033140613225
|
Organization name |
Institut Pasteur
|
Department |
Development and stem cell biology
|
Lab |
Mechanisms of Epigenetic Inheritance
|
Street address |
Institut Pasteur, 28 Rue Du Docteur Roux, Batiment Monod, 4eme Etage
|
City |
Paris |
ZIP/Postal code |
75724 |
Country |
France |
|
|
Platform ID |
GPL19757 |
Series (2) |
GSE125600 |
Small RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants (sRNA-Seq) |
GSE125601 |
Small RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants |
|
Relations |
BioSample |
SAMN10812979 |
SRA |
SRX5287756 |
Supplementary file |
Size |
Download |
File type/resource |
GSM3578030_WT_CRISPR_line2_F12_sRNA-seq_si_22GRNA_by_non_structural.bw |
4.8 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|