GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3564428

Query DataSets for GSM3564428

Status

Public on Jan 22, 2019

Title

NDM2_ACAGTG: MicV rep2

Sample type

SRA

Source name

whole bacterial cells

Organism

Vibrio cholerae C6706

Characteristics

strain: C6706
genotype: <delta>micV <delta>vrrA + pBAD-micV
growth phase: early stationary phase
treatment: 0.2% L-arabinose

Treatment protocol

The cells were treated with 0.2% L-arabinose in early stationary phase (OD600=1.5). After 10minutes of treatment 4 OD600 units of cells were harvested in tubes containing 1/5 vol. "stop-mix" (95% ethananol, 5% phenol) and snap frozen in liquid nitrogen until further processing.

Growth protocol

Vibrio cholerae C6706 ΔvrrA ΔmicV strains carrying pBAD-ctr, pBAD-vrrA or pBAD-micV plasmids were grown to early stationary phase (OD600=1.5) in 50ml LB media containing 50µg/ml kanamycin. At this point 0.2% L-arabinose was added to induce micV/vrrA expression and cells were harvested 10minutes after induction.

Extracted molecule

total RNA

Extraction protocol

RNA was isolated using Tri-reagent according to standard protocols. Prepared RNA was DNAse digested and cleaned up using standard nucleic acid precipitation procedures. Depletion of ribosomal RNA was performed using Ribo-Zero kits (Epicentre) for Gram-negative bacteria. Integrity of the prepared RNA was tested using a Bioanalyzer.
Directional cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Libary Prep Kit for Illumina (NEB E7760) according to the manufacturers instructions. Quality of the prepared libraries was tested using a Bioanalyzer.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 1500

Data processing

Sequencing of the cDNA libraries was performed by the LAFUGA service unit (Gene Center, munich, Blum group)
cDNA reads were imported into CLC Genomics Workbench v11.0 and analysed using mostly standard parameters.
3'adaptor- and quality trimming was performed using the trim reads command with the following settings: Sequence = TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, Strand = Minus, Action = Remove adapter, Scores = Mismatch: 2, Gapcost: 3, Cutoff: 10, Cutoff at end: 4
The trimmed reads were checked for quality and mapped to the V.cholerae reference genome: NCBI Acc.number: NC_002505, NC_002506 using the following settings: Mismatch cost = 2, Insertion cost = 3, Deletion cost = 3, Length fraction = 0.8, Similarity fraction = 0.8, Global alignment = Yes, Strand specific = Reverse, Maximum number of hits for a read = 1
Reads mapping in CDS were counted, and genes with a total count cutoff of >15 in all samples were considered for analysis. Read counts were normalized (CPM), and transformed (log2). Differential expression was tested using the built in tool corresponding to edgeR in exact mode with tagwise dispersions. Genes with a fold-change of > 3.0 in either condition and a FDR adjusted p-value < 1E-8 were considered to be differentially expressed.
Genome_build: NC_002505, NC_002506
Supplementary_files_format_and_content: Read count table and edgeR (exact mode) analysis

Submission date

Jan 16, 2019

Last update date

Jan 23, 2019

Contact name

Kathrin Fröhlich

E-mail(s)

kathrin.froehlich@uni-jena.de

Organization name

Friedrich-Schiller-Universität Jena

Department

Fakultät für Biowissenschaften, Bacterial RNA Biology