NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3401799 Query DataSets for GSM3401799
Status Public on Sep 03, 2020
Title RNA pooled from 5 larvae fed on Gomphocarpus physocarpus replicate 1 [GP-1]
Sample type SRA
 
Source name 5 whole body second instar D. plexippus larvae fed on Gomphocarpus physocarpus
Organism Danaus plexippus
Characteristics developmental stage: second instar
host: Gomphocarpus physocarpus
tissue: whole body
Treatment protocol Early 2nd instar larvae were transferred to fresh leaves of the three different Asclepias species (A. curassavica, A. linaria and G. physocarpus) and allowed them to feed for 24 hrs.
Growth protocol Monarch eggs were collected from leaves of A. curassavica wild plants and kept in the laboratory on the same leaves, in petri dishes, until larvae emerged. Once the larvae emerged we transferred them to fresh A. curassavica leaves until they achieved the 2nd instar stage.
Extracted molecule total RNA
Extraction protocol Larvae were collected after 24 hours, frozen immediately in liquid nitrogen and stored at -80C until the total RNA extractions were performed. Triplicates of five whole larvae for each treatment were homogenized using a Tissue Lyzer. Total RNA was extracted using the Direct-zol kit (Zymo), using the same total RNA to prepare mRNA and sRNA libraries.
The mRNA libraries were created using TruSeq RNA kit. The small RNA libraries were created using the Illumina TruSeq small RNA kit.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2500
 
Description processed data file: merge_Quan_OGS2.counts.tsv
GP-1.sorted.bam
Data processing All libraries were quality checked with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
reaper v16-098 (https://www.ebi.ac.uk/~stijn/reaper/reaper.html) was used to remove the Illumina small RNA Adapter sequence ("TGGAATTCTCGGGTGCCAAG") from sRNA-seq reads with the following parameters: -3p-global 14/2/1/0, -3p-prefix 8/2/0/2, -dust-suffix-late 20
RNA-seq paired-end reads were quality filtered and trimmed from adapter sequence with Trimmomatic v0.32 (http://www.usadellab.org/cms/?page=trimmomatic) with the following parameters: ILLUMINACLIP:TruSeq2-PE.fa:2:30:10, SLIDINGWINDOW:4:15, MINLEN:30
sRNA-seq reads were aligned with the alignment component of ShortStack 3.8.3 with parameters: --nostitch, --mismatches 1, --mmap u, --bowtie_m 500 and --ranmax 3.
RNA-seq paired-end reads were aligned with HISAT v2.1 with the following parameters: --max-intronlen 15000, -k 100
sRNA-seq read counts per gene were summarized with featureCounts v1.5.1 with "-s 1" and "-M" parameters.
RNA-seq read counts per gene were summarized with featureCounts v1.5.1 using "-p" and "-o" parameters.
Genome_build: The reference genome assembly for D. plexippus genome was Dpv3 from http://download.lepbase.org/archive/v2/sequence/Danaus_plexippus_v3_-_scaffolds.softmasked.fa.gz
Supplementary_files_format_and_content: Contain summarized counts from either protein coding genes (merge_Quan_OGS2.counts.tsv) or mature miRNAs (mature_miRNAannot.counts.tsv) as annotated in the supplementary files. One row per gene and one column per library.
 
Submission date Sep 26, 2018
Last update date Sep 03, 2020
Contact name Pablo M. Gonzalez-De-la-Rosa
E-mail(s) pablo.gonzalez@cinvestav.mx
Organization name Cinvestav
Department Langebio
Lab RNA computational genomics
Street address Km. 9.6 Libramiento Norte Carr. Irapuato-León
City irapuato
State/province guanajuato
ZIP/Postal code 36821
Country Mexico
 
Platform ID GPL25611
Series (1)
GSE120501 Genome-wide miRNA and protein coding expression of Danaus plexippus fed on three different hosts.
Relations
BioSample SAMN10132231
SRA SRX4740956

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap