GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2735667

Query DataSets for GSM2735667

Status

Public on Feb 13, 2019

Title

rPmt1Koq_rep1 [RNA-seq]

Sample type

SRA

Source name

AEP8_pmt1∆

Organism

Schizosaccharomyces pombe

Characteristics

strain: AEP8
genotype/variation: pmt1 knockout
growth medium: YES + 0.03 µM queuine

Growth protocol

Strains AEP1 and AEP8 were grown in full medium (YES) with 0.03 µM queuine, where indicated. Strains AEP99 and AEP100 were grown in minimal medium (EMM). Cultures were inoculated at an OD600 of 0.2 and grown to an optical density of 1.0.

Extracted molecule

total RNA

Extraction protocol

Ribosome footprinting was performed essentially as described (Duncan and Mata, 2014; Ingolia et al., 2011). S. pombe cultures were grown at 30°C to an OD600 of 1.0, 150 µg/ml cycloheximide was added to the medium and cells were incubated for further 15 min at 30°C. Cells were harvested and flash-frozen immediately in liquid nitrogen. 15 OD of each sample was lysed by adding 100 µl lysis buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 200µg/ml cycloheximide, 1% triton, protease inhibitor) and 1 g chilled glass beads (0.5 mm diameter). Samples were homogenized using a FastPrep-24 (MP Biomedicals) at level 6 for 13 seconds and subsequently diluted with 400 µl lysis buffer. Two centrifugation steps (1: 5 min, 4°C, 16000xg; 2: 15 min, 4°C, 16000xg) removed glass beads and cellular debris, respectively. For footprint isolation, 400 µl of the supernatants were digested with 4 U DNase I (ThermoScientific) and 800 U of RNase I (Ambion), for 45 minutes at room temperature with gentle shaking. 800 U of RNasin ribonuclease inhibitor (Promega) was added to quench the reaction. The samples were run on a 17.5 - 50% sucrose gradient to isolate monosomes. Footprint monosome RNAs were end-repaired with T4 polynucleotide kinase (TaKaRa), and size selected (28-31 nucleotides) on a 15% polyacrylamide Tris-borate-EDTA-urea gel. Total RNA was extracted from 100 µl lysate using TRIzol (Invitrogen) according to the manufacturers instructions.
Small RNA-seq: Small RNA libraries were constructed according to the protocol using NEB NEXT Small RNA library Prep Set for Illumina (Multiplex Compatible) E7330, and size-selected (120-170 base pairs) before sequencing. RNAseq: After quantification of total RNA and quality assessment on an Advanced Analytical Fragment Analyzer using the DNF-472 High Sensitivity RNA Analysis Kit (all Advanced Analytical Tech. Inc; Ankeny Iowa, U.S.A.), the mRNA was isolated from high quality total RNA extracts by using the NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490). Illumina-compatible RNA-libraries were constructed by using the NEBNext Ultra RNALibrary Prep Kit for Illumina (E7530) as well as the NEBNext Multiplex Oligos for Illumina (E7335) following the distributors instruction manuals. Multiplexed RNA libraries were mixed in equilibrium according to their Qubit (Life Technologies) measurements, fragment distribution profiles on the Advanced Anayltical Fragment Analyzer and quantification of library 5'-and 3'- ends by Real Time PCR. For each library, 30 Mio clusters were sequenced in a 1x 75 base mode on a Illumina NextSeq500 instrument according to the manufacturer’s protocol and using the NextSeq 500/550 High Output Sequencing Kit v2 (75 cycles) (Product Code: FC-404-2005).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Description

processed data file:
combinedRNAseqCounts.txt

Data processing

After quality and adapter trimming (AGATCGGAAGAGCACACGTCT), reads were aligned to fission yeast tRNA (CCA-appended sequences from gtrnadb.ucsc.edu and www.pombase.org), rRNA (www.arb-silva.de, www.pombase.org) and mitochondrial tRNA and rRNA sequences (www.arb-silva.de, www.pombase.org) using Bowtie allowing 2 mismatches, discarding any mapped reads from further analysis.
The remaining reads were aligned with Bowtie against cDNA sequences from www.pombase.org, allowing 2 mismatches and using 23nt as seed region.
Reads of length 26-29 nt whose 5' end map from 15 nt downstream of the CDS start of a gene and 3' end map from 5 nt upstream of the CDS stop were assigned to that gene.
Codon occupancy was calculated as the codon proportions in the A-site (read start +15-16nt) divided by averaged codon proportions in the 3 codon sites up and dowstream of the ribosome.
For RNA-seq, processing was done similarly except that reads were kept at any mapping position and if read length was at least 25 nt.
Genome_build: ASM294v2
Supplementary_files_format_and_content: tab-delimited text files containing codon occupancy, footprint counts assigned to each CDS for all samples, and RNA-seq read counts assigned to each mRNA for all samples.

Submission date

Aug 08, 2017

Last update date

May 15, 2019

Contact name

Ann E. Ehrenhofer-Murray

Organization name

Humboldt-Universität zu Berlin

Department

Institut für Biologie

Street address

Philippstr. 13