|
| Status |
Public on Mar 01, 2019 |
| Title |
b-catenin control cranial mesecnhyme + ectoderm |
| Sample type |
SRA |
| |
|
| Source name |
Manually dissected cranial mesenchyme plus ectoderm
|
| Organism |
Mus musculus |
| Characteristics |
antibody: H3K27me3 (Millipore #07-449)
developmental stage: e13.5
genotype/variation: EnlCre/+;RRbgal;Bcatflox/+
tissue: whole tissue
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
At E13.5, En1Cre;b-cateninfl/fl mutant and En1Cre;b-cateninfl/+ control cranial mesenchyme was isolated by manual dissection. An incision was made around the circumference of the neurocranium, and the tissue covering the brain was manually disassociated. The supraorbital cranial mesenchyme isolated consists of the neural crest and mesoderm derived cranial mesenchyme plus the ectoderm. 14 µg chromatin was immunoprecipitated with 4 µg rabbit anti-H3K27me3 (Millipore #07-449).
Illumina sequencing libraries were prepared from the ChIP and Input DNAs by the standard consecutive enzymatic steps of end-polishing, dA-addition, and adaptor ligation. After a final PCR amplification step, the resulting DNA libraries were quantified and sequenced on NextSeq 500. The libraries were made using the standard Illumina PE adaptor: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T; p-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
ChIP-seq reads were aligned to mm9 genome using Bowtie2
Peaks were called using Macs1.4 default settings
Drosophila DNA was “spiked in” during immunoprecipitation. The ratio of aligned Drosophila reads in the mutant versus control samples (calculated to be 1.3) was used to normalize the number of reads in the mouse samples by downsampling the larger sample (mutant, in this case).
Genome_build: mm9
Supplementary_files_format_and_content: called peaks. BigWig
|
| |
|
| Submission date |
Mar 14, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Radhika Paresh Atit |
| E-mail(s) |
rpa5@case.edu
|
| Phone |
2163688819
|
| Organization name |
Case Western Reserve University
|
| Department |
Biology
|
| Street address |
2074 Adelbert Road, Millis 316
|
| City |
Cleveland |
| State/province |
Ohio |
| ZIP/Postal code |
44106 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE96604 |
H3K27me3 enrichment in the supraorbital cranial mesenchyme with ectoderm upon the deletion of β-catenin |
| GSE96872 |
Supraorbital cranial mesenchyme with ectoderm upon the deletion of β-catenin |
|
| Relations |
| BioSample |
SAMN06624316 |
| SRA |
SRX2659813 |
