GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2328362

Query DataSets for GSM2328362

Status

Public on Dec 06, 2016

Title

GSC1_MS094_068

Sample type

SRA

Source name

GSC

Organism

Mus musculus

Characteristics

background strain: 129/SvJcl x C57BL/6
cell type: germline stem cells (GSCs)

Treatment protocol

GSC and GSCLC were cultured in StemPro-34 SFM (Invitrogen) supplemented with StemPro supplement (Invitrogen), 1% FBS, 1×GlutaMAXTM-I(Invitrogen), 1×minimal essential medium (MEM) Vitamin Solution (SIGMA), 5 mg/ml AlbuMAX-II (Invitrogen), 5×10-5 M 2-mercaptoethanol, 1×MEM nonessential amino acid solution (Invitrogen), 30 μg/ml pyruvic acid, 1×ITS-G (Invitrogen), 100 U/ml penicillin, 0.1 mg/ml streptomycin, and growth factors . [recombinant rat GDNF (10 ng/ml) (R&D Systems), human bFGF (10 ng/ml) (Invitrogen), LIF/ESGRO (103 U/ml) (Invitrogen), and mouse EGF (20 ng) (Invitrogen)]

Growth protocol

GSC_2 was derived from independent P7 testes. GSCLC_4 was derived from reconstituted testes cultured under condtion1 (cultured at 34°C for 3 weeks).

Extracted molecule

total RNA

Extraction protocol

GSCLCs/GSCs were incubated in 0.05% of Trypsin- 0.53mM EDTA for around 4 min at 37°C, and dispersed into single cells in 1% (vol/vol) KSR/PBS (Thermo Fisher Scientific). The cDNA synthesis was performed according to the SC3-seq method described previously (Nakamura et al., 2015).
The cDNA libraries for Nextseq500 (Illumina) were constructed based on the SC3-seq method with several modifications: Five nanograms of quality-checked cDNAs were added to the pre-amplification buffer [1 × ExTaq buffer [Takara Bio (RR006), Shiga, Japan], 0.2 mM of each dNTP [Takara Bio (RR006)], 0.01 µg/µl of the N-V3 (dT)24 primer (attachment of amine at the 5-prime end), 0.01 µg/µl of the V1(dT)24 primer and 0.025 U/ µl of ExTaqHS [Takara Bio (RR006)]], and were amplified by four cycles of PCR. The surplus primers and PCR byproducts such as primer dimers were removed by three rounds of purification using a 0.6 × volume of AMPureXP beads for each round [Beckman Coulter (A63881), Tokyo, Japan] according to the manufacturer’s instructions. The purified cDNAs were diluted to 50 µl by DDW and fragmented by shearing with Covaris E220 (duty factor: 20%; peak incident power: 175; cycles per burst: 200; duration: 60 s; an intensifier was installed in the case of E220) [Covaris, Woburn, MA, USA] and then end-polished in the End-polish buffer [1×NEBnext EndRepair Reaction buffer [NEB (B6052S), Ipswich, MA, USA], 0.01 U/ µl of T4 DNA polymerase [NEB (M0203)] and 0.033 U/ µl of T4 polynucleotide kinase [NEB (M0201)]] for 30 min at 20°C. After incubation, a 0.7 × volume of the AMPureXP was immediately added, the solution was mixed for more than 20 min and then the supernatant was transferred to a 0.9 × volume of the AMPureXP reagent and the cDNAs were purified. Next, to provide the purified cDNAs with an Rd2SP-adaptor sequence, the cDNAs were incubated in 30 µl of the Rd2SP adaptor extension buffer [1 × ExTaq Buffer, 0.23 mM of each dNTP, 0.67 µM of the Rd2SP-V1(dT)20 primer, 0.033 U/µl of ExTaqHS] using the following thermal cycler program: 95°C for 3 min, 67°C for 2 min, and 72°C for 2 min. The reactions were terminated by chilling in an ice-block, and after the addition of 20 µl of the Rd1SP-adaptor ligation buffer [a mixture of 10 µl of 5 × NEBNext Quick Ligation Reaction Buffer [NEB (B6058S)], 0.6 µl of 5 µM of the Pd1SP-T adaptor and 1 µl of T4 ligase [NEB (M0202M)]], the solution was incubated for 15 min at 20°C and for 20 min at 72°C. After two rounds of cDNA purification by adding a 0.8 × volume of AMPureXP, the cDNAs were added into the final amplification buffer [1 × ExTaq buffer, 0.2 mM of each dNTP, 1 µM of the S5XX index primer, 1 µM of the N7XX index primer (HPLCpurified), 0.025 U/µl of ExTaqHS] and amplified by PCR using the following thermal cycler program: 95°C for 3 min, 55°C for 1 min, and 72°C for 1 min; followed by ten cycles of 95°C for 30 s, 60°C for 1 min and 72°C for 1 min; with a final extension of 72°C for 3 min. Finally, the cDNA libraries were purified two times by using a 0.9 × volume of AMPureXP and dissolved in 30 µl of TE buffer.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Description

Single cell transcriptome of amplified cDNA from GS cell
AcrAct_EGFP reporter

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCC -g CTCGAGGGCGCGCCGGATCC -a AAAAAAAAAAAAAAAAAAAA -a TTTTTTTTTTTTTTTTTTTT". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome mm10 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—max-mle-iterations 50000", “—no-length-correction” and “—library-type fr-secondstrand” options and mm10 reference gene annotations with extended TTSs. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: mm10
Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample ...

Submission date

Sep 26, 2016

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology