|
| Status |
Public on Sep 17, 2016 |
| Title |
rep2_drug_PHA_PCR1 (rep2) |
| Sample type |
SRA |
| |
|
| Source name |
Immortalized human T lymphocyte Jurkat cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: T lymphocyte
days of post infection for sample analysis: 29
drug treatment: PHA
demultiplex indices used: ACGT, CATG
|
| Treatment protocol |
Samples used for the latency reversal experiments were treated with the indicated drugs for 24 hours before performing DNA and RNA extraction.
|
| Growth protocol |
Jurkat human T cells line were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% Pen Strep and 1% GlutaMAX (100x) at 37℃ under a 95% air/5% CO2 atmosphere. Jurkat T cells were passaged every 2 days with 1 to 5 dilution. After FACS sorting 4 days post infection, 20,000 GFP-positive cells were maintained in the same medium for the next 17 days without passage.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Genomic DNA and total RNA from the same infected cell pool were extracted by the AllPrep DNA/RNA Mini Kit. Total RNA was further proceeded to purify mRNA by Oligotex mRNA Mini Kit.
Libraries used for mapping HIV integrations were prepared by inverse PCR. Briefly, 3 µg DNA were harvested and digested by the restriction enzyme BplI. Fragments were blunt-end self-ligated in the total volume 1 mL at 16℃ overnight. The pellet was dissolved in 84 µL distilled water for plasmid-safe DNase treatment. DNase-treated samples were cleaned up by the QIAquick PCR purification kit. Samples were eluted in 20 µL EB buffer. 8 µL eluted product were used for two rounds of nested PCR. PCR products with different indexes were pooled together in the final concentration of 4 nM for sequencing 50 bp paired end on a Illumina NextSeq sequencer. RNA and DNA libraries were prepared by RT-PCR and regular PCR, respectively, with the same primers. RNA and DNA libraries were sequenced 50 bp single read by on a Illumina NextSeq sequencer.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
BHIVe trancripts with barcode 24h after PHA treatment, bio rep 1, tech rep 1
PHA_1_1_2
Jurkat_BHIVE_mini_drug.txt
|
| Data processing |
Library strategy: B-HIVE
Sequencing lane demultiplexing: Sequences were demultiplexed using bcl2fastq. In case the index was inside the sequenced amplicon, demultiplexing was carried out with custom scripts. The used indices are specified in the last row of the Sample section.
Barcode extraction: Barcodes were extracted from the forward reads. The barcode sequences in the construct are flanked by the Illumina adaptor and the T7 promoter sequence (TATAGTGAGTCGTATTAAAA). The promoter sequence was identified using Seeq (http://github.com/ezorita/seeq) allowing up to 2 mismatches.
Barcode clustering: Barcodes were clustered by sequence similarity using starcode and allowing up to 1 mismatch (http://github.com/gui11aume/starcode).
Alignment: Reverse reads were aligned on GRCh37/h19 using BWA-mem with default parameters.
Filtering on alignment quality: Only SAM mapping qualities greater or equal than 20 were used in the analysis.
Filtering of recombinant molecules: A barcode was associated to a mapped locus based on their co-ocurrence in paired-end reads. Associations between a barcode and a mapped locus reported by less than 10 paired-end reads were discarded. The remaining associations were considered reliable if both the barcode and the mapped locus were found together at least 90% of the time.
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: tab delimited tables
Supplementary_files_format_and_content: Jurkat_BHIVE_mini_integ.txt: BHIVE integration sites
Supplementary_files_format_and_content: Jurkat_BHIVE_mini_expr.txt: BHIVE transcript expression
Supplementary_files_format_and_content: Jurkat_BHIVE_mini_latent.txt: Latent integrations reference table
Supplementary_files_format_and_content: Jurkat_BHIVE_mini_drug.txt: Barcode reactivation upon treatment
|
| |
|
| Submission date |
Sep 07, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Guillaume Filion |
| E-mail(s) |
guillaume.filion@gmail.com
|
| Organization name |
CRG
|
| Department |
GRSCC
|
| Lab |
Genome Architecture
|
| Street address |
Dr. Aiguader 88
|
| City |
Barcelona |
| ZIP/Postal code |
08003 |
| Country |
Spain |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE82061 |
Position effects influence HIV provirus latency reversal |
|
| Relations |
| BioSample |
SAMN05736190 |
| SRA |
SRX2144008 |
